ID: 1201310440

View in Genome Browser
Species Human (GRCh38)
Location Y:12594338-12594360
Sequence TCTATAGGGTTACTGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201310433_1201310440 16 Left 1201310433 Y:12594299-12594321 CCTCTTTTTTCAGGTGTGAGGAG No data
Right 1201310440 Y:12594338-12594360 TCTATAGGGTTACTGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201310440 Original CRISPR TCTATAGGGTTACTGCAGCC AGG Intergenic