ID: 1201310440 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:12594338-12594360 |
| Sequence | TCTATAGGGTTACTGCAGCC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1201310433_1201310440 | 16 | Left | 1201310433 | Y:12594299-12594321 | CCTCTTTTTTCAGGTGTGAGGAG | No data | ||
| Right | 1201310440 | Y:12594338-12594360 | TCTATAGGGTTACTGCAGCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1201310440 | Original CRISPR | TCTATAGGGTTACTGCAGCC AGG | Intergenic | ||