ID: 1201311068

View in Genome Browser
Species Human (GRCh38)
Location Y:12598512-12598534
Sequence CTGGAGGCCTAGAGGCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201311059_1201311068 9 Left 1201311059 Y:12598480-12598502 CCACTGAGTTAGGTGTCCCTGAA No data
Right 1201311068 Y:12598512-12598534 CTGGAGGCCTAGAGGCCAGAGGG No data
1201311063_1201311068 -7 Left 1201311063 Y:12598496-12598518 CCCTGAAATGGGAGAGCTGGAGG No data
Right 1201311068 Y:12598512-12598534 CTGGAGGCCTAGAGGCCAGAGGG No data
1201311065_1201311068 -8 Left 1201311065 Y:12598497-12598519 CCTGAAATGGGAGAGCTGGAGGC No data
Right 1201311068 Y:12598512-12598534 CTGGAGGCCTAGAGGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201311068 Original CRISPR CTGGAGGCCTAGAGGCCAGA GGG Intergenic
No off target data available for this crispr