ID: 1201315266

View in Genome Browser
Species Human (GRCh38)
Location Y:12639509-12639531
Sequence CACAGGGAAATACCCAGGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201315259_1201315266 20 Left 1201315259 Y:12639466-12639488 CCAGTATTCCTTGCTGATTCTAG No data
Right 1201315266 Y:12639509-12639531 CACAGGGAAATACCCAGGTTCGG No data
1201315260_1201315266 12 Left 1201315260 Y:12639474-12639496 CCTTGCTGATTCTAGTCAGTGTT No data
Right 1201315266 Y:12639509-12639531 CACAGGGAAATACCCAGGTTCGG No data
1201315258_1201315266 30 Left 1201315258 Y:12639456-12639478 CCTAAAATGTCCAGTATTCCTTG No data
Right 1201315266 Y:12639509-12639531 CACAGGGAAATACCCAGGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201315266 Original CRISPR CACAGGGAAATACCCAGGTT CGG Intergenic
No off target data available for this crispr