ID: 1201315650 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:12643070-12643092 |
| Sequence | CTGAATATACAAATGGACAT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1201315646_1201315650 | 11 | Left | 1201315646 | Y:12643036-12643058 | CCTCAGAAAAAAACTGATCCTCT | No data | ||
| Right | 1201315650 | Y:12643070-12643092 | CTGAATATACAAATGGACATTGG | No data | ||||
| 1201315647_1201315650 | -7 | Left | 1201315647 | Y:12643054-12643076 | CCTCTCTCCTAACAGACTGAATA | No data | ||
| Right | 1201315650 | Y:12643070-12643092 | CTGAATATACAAATGGACATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1201315650 | Original CRISPR | CTGAATATACAAATGGACAT TGG | Intergenic | ||
| No off target data available for this crispr | |||||