ID: 1201315650

View in Genome Browser
Species Human (GRCh38)
Location Y:12643070-12643092
Sequence CTGAATATACAAATGGACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201315646_1201315650 11 Left 1201315646 Y:12643036-12643058 CCTCAGAAAAAAACTGATCCTCT No data
Right 1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG No data
1201315647_1201315650 -7 Left 1201315647 Y:12643054-12643076 CCTCTCTCCTAACAGACTGAATA No data
Right 1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201315650 Original CRISPR CTGAATATACAAATGGACAT TGG Intergenic
No off target data available for this crispr