ID: 1201320559

View in Genome Browser
Species Human (GRCh38)
Location Y:12693886-12693908
Sequence GTAAGTTCCCTCCTCTGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201320556_1201320559 13 Left 1201320556 Y:12693850-12693872 CCTATCTGCCTAGGCATTTGGCT 0: 79
1: 169
2: 167
3: 179
4: 450
Right 1201320559 Y:12693886-12693908 GTAAGTTCCCTCCTCTGAAGAGG No data
1201320551_1201320559 26 Left 1201320551 Y:12693837-12693859 CCAGGGACCTATCCCTATCTGCC No data
Right 1201320559 Y:12693886-12693908 GTAAGTTCCCTCCTCTGAAGAGG No data
1201320553_1201320559 19 Left 1201320553 Y:12693844-12693866 CCTATCCCTATCTGCCTAGGCAT No data
Right 1201320559 Y:12693886-12693908 GTAAGTTCCCTCCTCTGAAGAGG No data
1201320555_1201320559 14 Left 1201320555 Y:12693849-12693871 CCCTATCTGCCTAGGCATTTGGC 0: 58
1: 192
2: 155
3: 190
4: 249
Right 1201320559 Y:12693886-12693908 GTAAGTTCCCTCCTCTGAAGAGG No data
1201320557_1201320559 5 Left 1201320557 Y:12693858-12693880 CCTAGGCATTTGGCTGCCTCTTA No data
Right 1201320559 Y:12693886-12693908 GTAAGTTCCCTCCTCTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201320559 Original CRISPR GTAAGTTCCCTCCTCTGAAG AGG Intergenic
No off target data available for this crispr