ID: 1201325759

View in Genome Browser
Species Human (GRCh38)
Location Y:12756014-12756036
Sequence GGAGTGATGTTTTTTGCAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201325751_1201325759 14 Left 1201325751 Y:12755977-12755999 CCCTGTGTGGTCCACACTTCTAA 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1201325759 Y:12756014-12756036 GGAGTGATGTTTTTTGCAACGGG 0: 1
1: 0
2: 0
3: 11
4: 152
1201325749_1201325759 16 Left 1201325749 Y:12755975-12755997 CCCCCTGTGTGGTCCACACTTCT 0: 1
1: 0
2: 2
3: 20
4: 167
Right 1201325759 Y:12756014-12756036 GGAGTGATGTTTTTTGCAACGGG 0: 1
1: 0
2: 0
3: 11
4: 152
1201325753_1201325759 3 Left 1201325753 Y:12755988-12756010 CCACACTTCTAACTTCTACCATG 0: 1
1: 0
2: 1
3: 18
4: 246
Right 1201325759 Y:12756014-12756036 GGAGTGATGTTTTTTGCAACGGG 0: 1
1: 0
2: 0
3: 11
4: 152
1201325752_1201325759 13 Left 1201325752 Y:12755978-12756000 CCTGTGTGGTCCACACTTCTAAC 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1201325759 Y:12756014-12756036 GGAGTGATGTTTTTTGCAACGGG 0: 1
1: 0
2: 0
3: 11
4: 152
1201325750_1201325759 15 Left 1201325750 Y:12755976-12755998 CCCCTGTGTGGTCCACACTTCTA 0: 1
1: 0
2: 2
3: 18
4: 155
Right 1201325759 Y:12756014-12756036 GGAGTGATGTTTTTTGCAACGGG 0: 1
1: 0
2: 0
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201325759 Original CRISPR GGAGTGATGTTTTTTGCAAC GGG Intronic
900581923 1:3413655-3413677 GGGGTGCTGTGTCTTGCAACGGG + Intronic
901791211 1:11654586-11654608 GGAGTCGTTTTTTTTCCAACTGG + Exonic
907518742 1:55009531-55009553 AGAGTGATTTTATCTGCAACAGG - Exonic
907949112 1:59163888-59163910 GGAATGATGTTTTTTCAAATTGG + Intergenic
908323712 1:63002937-63002959 GGAGGGTTTTTTTTTTCAACTGG + Intergenic
911372721 1:97013658-97013680 GTAGTAATGTTTTTTGCACCTGG + Intergenic
912598128 1:110900011-110900033 GGAGTAATATTTTATGCAGCAGG - Intergenic
913717871 1:121556524-121556546 AAAGTGATGTTTTTTTCTACTGG - Intergenic
915666736 1:157451851-157451873 GGAGTGAAGTTTATTGAAAAAGG - Intergenic
915890321 1:159767467-159767489 TGAGTGATGCATTTTGCAATGGG - Intergenic
917748153 1:178030564-178030586 GGAGTTATGATTTTTGTAAGTGG + Intergenic
918148428 1:181778237-181778259 AGACTGACATTTTTTGCAACTGG - Intronic
920452154 1:206067647-206067669 GGAGTGAGGTATTTGGGAACAGG - Intronic
922433315 1:225577875-225577897 GGAGTAATCTTTTTTTCAATAGG + Intronic
922873815 1:228924245-228924267 CAAGTTATGTTTTTTGCAAATGG - Intergenic
924894710 1:248323919-248323941 GAAGTGATGATGATTGCAACAGG + Exonic
1064847276 10:19669119-19669141 GGAGTGATCTTCTTAGAAACTGG + Intronic
1070120932 10:73576066-73576088 GGACTGAAGATTTTTCCAACTGG + Intronic
1071680113 10:87696246-87696268 AGAGCTATGTTTTTTGAAACAGG - Intronic
1076159545 10:128232927-128232949 GCAGTGATGATGTTTTCAACAGG - Intergenic
1077575511 11:3379934-3379956 GGAGAGATGTTTGTAGCAAGAGG - Intergenic
1078837033 11:15040850-15040872 GGAGTGATGTATTTTGAAAATGG - Intronic
1079300486 11:19274752-19274774 GGAGTGAAATTTTCTGCAACTGG - Intergenic
1079637850 11:22767546-22767568 TGAATGATTTTTTTTGCAAAGGG + Intronic
1083283823 11:61644859-61644881 AGAATGATGATTTTTGCACCAGG - Intergenic
1083588836 11:63880319-63880341 GGAATGCTGATTTTTGCAGCAGG + Intronic
1086332632 11:85769366-85769388 GGAGTGATGTGTTTTGAAGATGG + Intronic
1087036747 11:93763926-93763948 AGAGTGATGTTTCTTGCATGTGG + Intronic
1087694660 11:101362791-101362813 GGAGTGATGTTTTTGGCACTTGG + Intergenic
1094717516 12:33027879-33027901 GGAGAGGTGTTTTCTGCAAGTGG + Intergenic
1096880658 12:54666335-54666357 GGAGGAATGTTCTTTACAACGGG + Intergenic
1101187390 12:102293386-102293408 GGAGTGATGCATTTTGCAGATGG + Intergenic
1104549219 12:129740733-129740755 GAAGTGATTTTTTTTTCAATAGG - Intronic
1104888804 12:132129223-132129245 TGAGTGCTGTTTTATGGAACCGG - Intronic
1106936208 13:34723633-34723655 GGATTAATATTTTTTGAAACTGG - Intergenic
1110467228 13:75815660-75815682 GGAAAGATGTTTGTTGAAACTGG + Intronic
1111912941 13:94332028-94332050 GCAGTAATGCTTTGTGCAACAGG + Intronic
1112611602 13:100960366-100960388 GTAGAGATGATTTTTGAAACAGG - Intergenic
1112750525 13:102578866-102578888 GGAGTGAGGATTTTGGCTACAGG + Intergenic
1112832390 13:103469473-103469495 GAAGTGATGCTTTCTTCAACAGG + Intergenic
1113583736 13:111448647-111448669 GGAATGATGTGGTGTGCAACAGG + Intergenic
1115542948 14:34439806-34439828 GGACTGATTTGTTTTGGAACTGG - Intronic
1117865652 14:60146378-60146400 GAAGTGATTTTTTTTTCAAAGGG - Exonic
1122286779 14:100657063-100657085 GGAGTGAGCTTCTTTGCCACTGG + Intergenic
1122449419 14:101793248-101793270 AGAGGGATGTTTATTGCTACTGG + Intronic
1122702772 14:103601371-103601393 GGAGTAATTTTTTTTGAAACAGG + Intronic
1123831447 15:24142619-24142641 ATAGTGATGTTTTTTCCAAAAGG - Intergenic
1123836403 15:24198332-24198354 ATAGTGATGTTTTTTCCAAAAGG - Intergenic
1125062038 15:35436785-35436807 GGAGTTAAGTTTTATGCAAGAGG + Intronic
1125950579 15:43748095-43748117 TGAGTGATGCTTTTTACTACAGG + Intronic
1128523401 15:68390428-68390450 GGAGTGATGTTCTTTCTCACTGG + Intronic
1128539624 15:68517590-68517612 GGAGTGCTGTGTTCTGCAGCTGG + Intergenic
1131297824 15:91167523-91167545 GAAGTGATGTGTTTTGCAGATGG - Intronic
1131876815 15:96816421-96816443 AGAGTGATCTTTTTTGCACTTGG - Intergenic
1131889331 15:96955611-96955633 TGAGTGAGGCTTTTTGCCACTGG - Intergenic
1134289512 16:12892467-12892489 GGAGTGATGTTTCTTGAAGAGGG - Intergenic
1134839587 16:17391144-17391166 GGAGTGATGTTATCTGCAGGAGG - Intronic
1136740253 16:32514291-32514313 GGATTTTTGTTTTTTGCAATTGG + Intergenic
1137451172 16:48575864-48575886 GGAGTGATGCTCCTTGCAGCTGG - Intronic
1138072889 16:54010568-54010590 GGACTGATTTTTTTTTTAACAGG - Intronic
1140114895 16:72033587-72033609 GGAGTGAACTTTTTTGCATAGGG - Intergenic
1203012688 16_KI270728v1_random:313563-313585 GGATTTTTGTTTTTTGCAATTGG - Intergenic
1203031023 16_KI270728v1_random:586722-586744 GGATTTTTGTTTTTTGCAATTGG - Intergenic
1203040698 16_KI270728v1_random:747709-747731 GGATTTTTGTTTTTTGCAATTGG + Intergenic
1143380777 17:6494931-6494953 GGTGAGTTGTTTTTTGCAATGGG - Intronic
1146832792 17:36084316-36084338 CTAGTGATGTTTTTTCCAATGGG + Intergenic
1148337164 17:46849760-46849782 GGTGTGATGGTGTTTACAACTGG - Intronic
1148988365 17:51644120-51644142 GCATTGATTTTTTTTGTAACTGG + Intronic
1149139030 17:53407679-53407701 CAAGAGATGTTTATTGCAACAGG - Intergenic
1150570693 17:66384348-66384370 GTAGTGATTTGTCTTGCAACAGG + Intronic
1151013589 17:70530134-70530156 GAAGTGTTGTGTTTTGCAAATGG - Intergenic
1151028460 17:70706666-70706688 GGAGTGGTGCTTTTAACAACAGG + Intergenic
1151062347 17:71110563-71110585 TGTGTGCTGTTTGTTGCAACAGG - Intergenic
1154488000 18:14893277-14893299 GGAGTGATGTTCCTTTCAATAGG + Intergenic
1159653203 18:71001514-71001536 GTAGTGGTGTTTTTTGAAGCTGG + Intergenic
1165234344 19:34408520-34408542 GGAGTGAGGTTTTTAGTAAGTGG + Intronic
925755894 2:7132489-7132511 GGAGTGAATTTTTTTGAAACAGG + Intergenic
928029016 2:27763087-27763109 GCAGTGTTGTTTTTTTCATCAGG - Intergenic
928800956 2:35090967-35090989 TGAGAGATGTATTTTACAACAGG + Intergenic
928833360 2:35515570-35515592 GGGGTGATGTTTTTTGCCTCTGG + Intergenic
929309099 2:40401091-40401113 TGGGTGATGATTTCTGCAACTGG - Intronic
930094239 2:47554643-47554665 AGAGTCAGATTTTTTGCAACAGG + Intronic
930882398 2:56286982-56287004 GGAGTGGTGTTTTCTCCAAGGGG + Intronic
931179873 2:59888668-59888690 GGAGTGAAGTTTCTAGCAAGAGG + Intergenic
933182567 2:79243863-79243885 GGAGTGCACATTTTTGCAACAGG + Intronic
939202650 2:139057901-139057923 GGAGAGATTTTTTTTTTAACTGG - Intergenic
940029937 2:149251263-149251285 TTAGTGATTTTTTTTGCAAGTGG + Intergenic
940868906 2:158843488-158843510 GGAGTGATGCTTGTTGGAAATGG - Intronic
942426944 2:175870116-175870138 GGAGTGATGCTTTTTCCAGGAGG + Intergenic
944115101 2:196177357-196177379 GGAGTGATCTTTGTGTCAACTGG + Intergenic
944717948 2:202394044-202394066 GGAGTAATCTTTTATACAACCGG - Intronic
944978888 2:205091354-205091376 GGAGTGATGTATTTTCAAAGAGG + Intronic
946045870 2:216820533-216820555 GGAGTAATGTTTACTGCTACAGG + Intergenic
1169382164 20:5117534-5117556 GGAGTGAAATTTTCTGCAAGTGG - Exonic
1169737678 20:8854538-8854560 GATGTGTTGTTTTTTGCAAGGGG + Intronic
1171394406 20:24822433-24822455 AGACTGGTGTTTTTTGCAAATGG - Intergenic
1171940529 20:31324556-31324578 TGAGTGATGCTGTTGGCAACAGG + Intergenic
1173867670 20:46322965-46322987 GGAGTGATTTTCTTTACAATTGG + Intergenic
1176018142 20:62948206-62948228 CGCGTGTTGTTTTTTACAACAGG + Exonic
1177117283 21:17101722-17101744 AGAGTGATCTGCTTTGCAACAGG + Intergenic
1178540926 21:33449148-33449170 GAAGTAATATTTATTGCAACAGG + Exonic
1182744672 22:32596478-32596500 GGAGAGATGTTCTGTGCACCAGG + Intronic
1183169144 22:36172160-36172182 GGAGTGAGGTATTTGGGAACAGG + Intergenic
1184917782 22:47584349-47584371 AGAGTGTTTTCTTTTGCAACAGG + Intergenic
949627836 3:5887893-5887915 GGAGGAATATTTTTGGCAACAGG + Intergenic
949692825 3:6660932-6660954 GGAGTGATATTTTCTACACCTGG - Intergenic
953026035 3:39145581-39145603 GGATTTCTGTGTTTTGCAACAGG + Intronic
955819878 3:62885479-62885501 GTAGATATGTTTTTAGCAACTGG + Intergenic
960189855 3:114690398-114690420 GTAGTGATGTGTTGTCCAACAGG - Intronic
961930358 3:130526609-130526631 GCAGTGATGTGGTTTGCAGCTGG + Intergenic
966394486 3:179488110-179488132 GTAGTGATGGCTTTTGGAACAGG - Intergenic
966641012 3:182190512-182190534 GAAGTGATGTTATTTGGAAGTGG + Intergenic
966710500 3:182967689-182967711 TGAGGGATGTGTTTTGCAATGGG - Intronic
971240375 4:24883102-24883124 GGAGCCTTGTTCTTTGCAACTGG - Intronic
972017245 4:34262642-34262664 GAAGTGATGATTTTTGTAAGGGG - Intergenic
972026045 4:34379147-34379169 GTAATGAAGTTTTTTACAACAGG + Intergenic
977623205 4:99161202-99161224 GGAGTGAATTTTTCTGCAAATGG - Intergenic
978134122 4:105235895-105235917 GGTGTGAGGGTTTTTGGAACTGG - Exonic
980450709 4:132967306-132967328 AGATTGATATTTCTTGCAACAGG + Intergenic
981696979 4:147568769-147568791 GGATTGATATTCTTTGCAATTGG - Intergenic
983741241 4:171137355-171137377 TAAGTGATGTAATTTGCAACAGG + Intergenic
984986232 4:185332500-185332522 GGAATGTAGTATTTTGCAACAGG + Intronic
987142715 5:14961739-14961761 TGAGGGATGTTTTTTGCATTGGG + Intergenic
987957284 5:24756431-24756453 GAAGTCATGTATTTTGCAACTGG - Intergenic
989810561 5:45667819-45667841 GGAGTTGTTTTTTTAGCAACTGG - Intronic
990564508 5:57015654-57015676 GGAGTGATGCACTTTGCAACAGG + Intergenic
991103185 5:62816071-62816093 GGAGAAATGTTTATTGAAACAGG + Intergenic
995252396 5:110008422-110008444 GGACTGATGTTTTTTATACCTGG - Intergenic
996587776 5:125110369-125110391 GGAGTGATGTATTTTGTAGAGGG + Intergenic
999358678 5:150963054-150963076 AGAATGCTGTCTTTTGCAACAGG + Intergenic
999562318 5:152818041-152818063 TGAGTAATGTTTTTTAAAACTGG - Intergenic
1000325941 5:160172460-160172482 TTAGTAATGATTTTTGCAACAGG + Intergenic
1002321962 5:178381639-178381661 GGAGTGGTTTTTTTTGAGACAGG + Intronic
1005379530 6:25218688-25218710 GGTGTGATATTTTCTGCAACTGG - Intergenic
1007473704 6:42106018-42106040 GGAGTGATGTAGTTGGCAGCAGG + Exonic
1017598313 6:156053895-156053917 CGAGTGATTATTTTTGGAACCGG - Intergenic
1018444592 6:163843748-163843770 AGAGAGATGATTTATGCAACTGG - Intergenic
1019840016 7:3431859-3431881 GGAGTGATTTTTTTTTTAAATGG + Intronic
1022920997 7:35014736-35014758 GGAGTGATCTTATTTGGAAATGG + Intronic
1024422500 7:49185493-49185515 GAAATCATGTTTTTTGCAGCTGG + Intergenic
1027555481 7:79659613-79659635 GGAGTGATGTGCTTTGAAAGTGG + Intergenic
1030240652 7:107319795-107319817 CAGGTGATGTTTTTTGAAACTGG - Intronic
1031403421 7:121353634-121353656 GGAGTCTGGTATTTTGCAACAGG + Intronic
1035689652 8:1551647-1551669 GGAGGGATGGTTTTTGAAAGGGG - Intronic
1036727980 8:11237304-11237326 GGAATGATGTTTTGTTCATCTGG + Intergenic
1046430244 8:114114831-114114853 GAAGTGATATTCTTTGAAACTGG - Intergenic
1051166922 9:14272563-14272585 GGATTTATGTTTTATGAAACTGG - Intronic
1051503615 9:17804548-17804570 GAAGTGATGTGTTTTGAATCTGG - Intergenic
1052498591 9:29260053-29260075 GGAGTTATGTATTTGGCAGCTGG - Intergenic
1053828510 9:42050254-42050276 ACAGTGATGTTTTCTGAAACAGG - Intronic
1054602051 9:67137200-67137222 ACAGTGATGTTTTCTGAAACAGG + Intergenic
1058675790 9:107398893-107398915 GGAGTGATGCTTTTTGGCAAGGG + Intergenic
1059202181 9:112428409-112428431 AGAGTGTTGTTTTTTGCAGTGGG + Intronic
1059933903 9:119288620-119288642 GGGGTGATATTTTTAGCAAGAGG + Intronic
1062033146 9:134371155-134371177 GGAGGGATGACTTTTGTAACTGG - Intronic
1187773336 X:22727586-22727608 GAAGTGATGATTGTTGCATCTGG - Intergenic
1193758449 X:85437074-85437096 GGAGTATTGTATTTTGCAACGGG + Intergenic
1196202582 X:112902224-112902246 GGAGCGATATTTTTGGCAAAGGG + Intergenic
1199366158 X:146986413-146986435 GGAGTTATCTCTTTTGCAAATGG + Intergenic
1199391978 X:147290751-147290773 GGAGTGAGGTAATGTGCAACAGG - Intergenic
1200915502 Y:8567838-8567860 AGAGTGGCTTTTTTTGCAACGGG - Intergenic
1201325759 Y:12756014-12756036 GGAGTGATGTTTTTTGCAACGGG + Intronic
1201507859 Y:14724323-14724345 GGTGTGCTGAATTTTGCAACTGG + Intronic
1202028128 Y:20546170-20546192 GGAGGGATGTATCTTTCAACTGG - Intergenic