ID: 1201327588

View in Genome Browser
Species Human (GRCh38)
Location Y:12780933-12780955
Sequence CTGGAAAATGGCTCATTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201327588_1201327590 -6 Left 1201327588 Y:12780933-12780955 CCTACAAATGAGCCATTTTCCAG 0: 1
1: 0
2: 2
3: 17
4: 199
Right 1201327590 Y:12780950-12780972 TTCCAGCTCCAAGACTAAATTGG 0: 1
1: 0
2: 0
3: 5
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201327588 Original CRISPR CTGGAAAATGGCTCATTTGT AGG (reversed) Intronic
902090873 1:13902180-13902202 AAGAAAAATGGCCCATTTGTGGG + Intergenic
902621579 1:17653964-17653986 CTGGAAAAGGGCCCAGTGGTCGG + Intronic
905303480 1:37001564-37001586 CTGGCCATTTGCTCATTTGTGGG + Intronic
906989220 1:50720257-50720279 CTTAAAAGTGGCTCATTTTTTGG - Intronic
907251768 1:53144198-53144220 TTGGAAAATGAGGCATTTGTTGG - Intergenic
912237505 1:107867752-107867774 CTGGAAGCTGGCTAATTTGTGGG + Intronic
913295746 1:117318445-117318467 CTGTAAAATGTGTCATATGTTGG + Intergenic
914745643 1:150499124-150499146 CTGGTGAGTGGGTCATTTGTTGG + Intronic
917910875 1:179644219-179644241 ATGGAAAATGGTTAATATGTGGG + Intronic
919751424 1:201040421-201040443 CTGGAATTTTGCTCATTGGTGGG - Intronic
920136858 1:203776767-203776789 CTGGAAAATTGGTCAGCTGTTGG + Intergenic
920316240 1:205077396-205077418 CTGCCAACTGGCTCATTGGTGGG + Exonic
921595378 1:217048644-217048666 CTTTAAAATGGCTCATTTCAGGG - Intronic
921756894 1:218868122-218868144 CTGGAACATTGGGCATTTGTTGG - Intergenic
924526144 1:244851435-244851457 ATTTAAAATGTCTCATTTGTGGG - Intronic
1064421718 10:15196460-15196482 CTGGGAAATGGCTCTGTTCTAGG + Intergenic
1065822710 10:29540618-29540640 CTGGAAAATGGCTGCTTCCTTGG + Intronic
1066481254 10:35797858-35797880 CAGAAAGATAGCTCATTTGTGGG - Intergenic
1067757921 10:49019200-49019222 CTGTAAGATGGCACATATGTTGG - Exonic
1067804338 10:49382715-49382737 CTGGAGAATGGCTGGTGTGTTGG - Intronic
1070398356 10:76032171-76032193 CTGGTGAGTGGCTCATTTGCAGG + Intronic
1070498946 10:77052356-77052378 ATAGAAAATGGATCATGTGTGGG + Intronic
1072955177 10:99881831-99881853 CTGAAAAATGTCACATTTCTTGG - Intronic
1074997591 10:118771141-118771163 CTGGCAAATATCTCTTTTGTGGG + Intergenic
1075559584 10:123458832-123458854 CTGTAAAATGGGGCATTTGAAGG - Intergenic
1080115655 11:28618824-28618846 CAGGAAAATGCCTCTTTTCTGGG + Intergenic
1080831347 11:35896105-35896127 CTGGAAAAGTCCCCATTTGTTGG + Intergenic
1080948511 11:37001946-37001968 GTGTAAAATGTCTCATTTTTAGG + Intergenic
1081733763 11:45389612-45389634 CTGTAAAATGGCTTTTGTGTTGG + Intergenic
1082674860 11:56084657-56084679 CTGCAAAATGGCTCAGCTCTTGG - Intergenic
1082947116 11:58772292-58772314 CTGGTAAATAGGGCATTTGTAGG + Intergenic
1083020895 11:59505878-59505900 CTGGAAAATCGGTCCTTTGATGG - Intergenic
1085444677 11:76592410-76592432 CTGGGAAATGCTGCATTTGTGGG + Intergenic
1085725959 11:78954905-78954927 CTTGCAAAAGGCTCATCTGTTGG - Intronic
1088056133 11:105581600-105581622 CTGGAAAGTGTTTCATTTGCAGG - Intergenic
1090737135 11:129619758-129619780 CTGGGGAATGGTTCACTTGTGGG + Intergenic
1092838389 12:12514516-12514538 CTTGAAAATGGTTCCTTTTTTGG + Intronic
1095301532 12:40590126-40590148 CTTGAAAATGGCACATTTGTGGG - Intergenic
1096064659 12:48730002-48730024 CTGGAAAAAGGGAAATTTGTAGG - Intergenic
1097816880 12:64084313-64084335 CTTCAAAATGGCTTATATGTTGG + Intronic
1100654004 12:96620837-96620859 CTGGGAAATGGCTCAGCTGTGGG + Intronic
1102756638 12:115346871-115346893 CTGTAAAATGGGTCAGCTGTAGG - Intergenic
1102882813 12:116498793-116498815 ATGGAAAATAGTTAATTTGTTGG + Intergenic
1107063431 13:36186528-36186550 CTGGAAAAGTCTTCATTTGTGGG + Intronic
1107718243 13:43221672-43221694 CTGGAAAATAGCTTATTATTGGG + Intronic
1110279082 13:73671751-73671773 CTGGAAAATGCCATATATGTAGG + Intergenic
1111124981 13:83903622-83903644 GTGGAAAAATACTCATTTGTTGG + Intergenic
1112278455 13:98042434-98042456 CTGGAAAATTGAACATCTGTAGG + Intergenic
1113346286 13:109481795-109481817 CTGGAAAATGATTCAGTTGATGG + Intergenic
1113682863 13:112256399-112256421 AAAGAAAATGGCTCATTTATGGG - Intergenic
1117225264 14:53651940-53651962 CTAGAAAATCTCTCATTTTTTGG + Intergenic
1117512497 14:56467382-56467404 ATGGAAAATGTTTCATGTGTTGG - Intergenic
1117895145 14:60476476-60476498 ATGGAAAATAACTCATTTGTTGG - Intronic
1121480577 14:94267909-94267931 CTGTAAACTGGTTCATTTGCTGG + Intronic
1122244026 14:100388654-100388676 CTGGGAAATGTCTCATTTGTTGG - Intronic
1122461529 14:101899567-101899589 CTGGAAAAGGTATCATTTCTGGG - Intronic
1202934287 14_KI270725v1_random:70263-70285 CCCACAAATGGCTCATTTGTGGG + Intergenic
1125028362 15:35052809-35052831 CTGGAATAAGGCTCATTTCTAGG + Intergenic
1127237140 15:57066634-57066656 CTGCAAAATGAGTAATTTGTTGG + Intronic
1127818014 15:62629557-62629579 TTGGAAAATACCTCATTTGGGGG - Intronic
1129079157 15:73024131-73024153 CTGGGAAGAGTCTCATTTGTTGG + Intergenic
1129914746 15:79258931-79258953 CTGGAAACAGGCTCAGTTGGGGG - Intergenic
1133360883 16:5172981-5173003 CTGGAAAATGGACCATCAGTAGG - Intergenic
1137691378 16:50430359-50430381 CTGGAAAATGGCTCAGCAGCTGG + Intergenic
1139073587 16:63415229-63415251 CTGTACAAGGGCTCATTTGCTGG + Intergenic
1139787335 16:69404482-69404504 CTGTCACATGGCTAATTTGTTGG + Intronic
1140596513 16:76421715-76421737 CTTGAAAATAGGTCATGTGTAGG + Intronic
1141172068 16:81697792-81697814 CTTGAAAAGGGCTTATTTTTAGG + Intronic
1141735802 16:85851812-85851834 CTTGAAAAAGGATCATTTGAGGG + Intergenic
1144181840 17:12759468-12759490 CTGATAAATGACTCATTTTTTGG + Intronic
1148209662 17:45800529-45800551 CTGGGAGATGGACCATTTGTGGG - Intronic
1148531029 17:48392269-48392291 CTTGAACGTGTCTCATTTGTGGG - Intronic
1149055481 17:52358334-52358356 CTGGACAACGGGTCATTTATTGG - Intergenic
1150310340 17:64123344-64123366 TTGTTAAATGACTCATTTGTGGG - Intronic
1150335063 17:64325086-64325108 CTGGAAAATGGTGAATTTGCCGG + Intronic
1150516052 17:65810371-65810393 TTGGAATATGGGTCATTTCTGGG + Intronic
1154174447 18:12076341-12076363 CTGCAGAATGGCTCATTTTCTGG - Intergenic
1155788592 18:29933963-29933985 TTGGAACATGGGTTATTTGTAGG - Intergenic
1156071209 18:33212358-33212380 CTGGACAATGGGTCATATGCTGG - Intronic
1156093285 18:33497662-33497684 CTGGAAAACAGCTGATTTGTTGG + Intergenic
1156633783 18:39001982-39002004 CTAGAAAAGGTCTCATTTTTCGG - Intergenic
1156878796 18:42050141-42050163 CTGGAAAATGCCTCTTTTTATGG + Intronic
1157980418 18:52373380-52373402 CTGAAAAATTGCTGATTTGTGGG - Intronic
1158240679 18:55374514-55374536 CTGGAAAATGGATGTTTTCTAGG + Intronic
1158923057 18:62215635-62215657 CTGCAAAATAGGTCATTTTTAGG + Intronic
1159285992 18:66352544-66352566 GTGGAAAATGCCTCATATGAGGG + Intergenic
1161462816 19:4408821-4408843 CTTGAAAATTACTGATTTGTTGG - Intronic
1163195854 19:15719413-15719435 CTGGAAGATTGCTCATGTGTGGG + Intergenic
1164009665 19:21189388-21189410 CAGGAAAATGGCTCAAATCTGGG + Exonic
1166119732 19:40678573-40678595 GTGTCAAATGGCTCATTTCTTGG - Intronic
1166587801 19:43966614-43966636 GTGGAAAAGGCTTCATTTGTAGG + Exonic
925020697 2:565430-565452 CTGGAAAATGGGGCATTAGAAGG - Intergenic
927304286 2:21552942-21552964 CTGGTATATAGTTCATTTGTTGG - Intergenic
927611430 2:24545190-24545212 CTGGAAAATGGCTGATTCTTGGG + Intronic
927816223 2:26219930-26219952 CTGTAAACTAGCTCATTTCTGGG - Intronic
927854741 2:26520940-26520962 CTGGAAAATGTGTCACTGGTGGG + Intronic
928826078 2:35422831-35422853 CTGAAAAATGGGTGATTTGATGG - Intergenic
930615137 2:53585651-53585673 CTTGAAAATGGATCACTCGTAGG - Intronic
931733032 2:65169855-65169877 TAATAAAATGGCTCATTTGTTGG - Intergenic
931929143 2:67109230-67109252 TTGGAAAATGGCTGATTTCAGGG - Intergenic
934876132 2:97922726-97922748 CTGGAAAATGGCTAACTTTATGG + Intronic
935163404 2:100548739-100548761 CTGAACAATGGCTCAGTTCTTGG - Intergenic
935310893 2:101782216-101782238 ATGCAAAATGACTCATTTATTGG + Intronic
935517417 2:104058275-104058297 CAGGAAAATGGCTCATTCAAAGG + Intergenic
935632201 2:105221364-105221386 CTGGAACATGCCCCATATGTTGG + Intergenic
935871825 2:107459209-107459231 CTGGAAAATTGAATATTTGTAGG + Intergenic
937954238 2:127410924-127410946 ATGAAAAATGACTCATTTTTTGG - Intergenic
938203712 2:129399338-129399360 CTGTAAACTGGCTCAATTCTGGG - Intergenic
938228942 2:129641165-129641187 ATGTCAAATGGCTCATTTATAGG - Intergenic
938989462 2:136612914-136612936 CTGGACCATGGCTCATTCCTGGG + Intergenic
939979808 2:148766578-148766600 CTGGAAAATTACTCTTTTGTAGG - Intronic
944978032 2:205079919-205079941 CTGGAAAATGGTTGATTTCTGGG - Intronic
1172939220 20:38643389-38643411 CTGGAACATGGGTCATTTCCTGG - Intronic
1174766728 20:53261388-53261410 CTGGAATTTGGGTCATTTCTTGG - Intronic
1175710811 20:61219275-61219297 GTGGAAAATGACTCATCTTTGGG + Intergenic
1177536693 21:22437456-22437478 CTTGAAATTGGCTCATCCGTTGG + Intergenic
1179656545 21:42849496-42849518 CTGGAGAGTGGCTCCCTTGTGGG - Exonic
1179994666 21:44968327-44968349 CTGGCAAATGGCTCAATGGGTGG - Intronic
1183141210 22:35941683-35941705 ATGGAATATGGTTCATATGTGGG - Intronic
1184345478 22:43910178-43910200 TGGGACAATGGCTCATTTGCAGG - Intergenic
949913761 3:8939832-8939854 CTGGGTAATGGCTAAATTGTGGG + Intronic
950554544 3:13687293-13687315 CTGTAAAATGGCTAAGTTGTGGG - Intergenic
950568772 3:13787397-13787419 CTGCAAAATGGGTTAATTGTGGG - Intergenic
955728614 3:61959661-61959683 CTGGAGAATGACTAATTTGATGG + Intronic
956368329 3:68530692-68530714 TTCGAAAATGGTTCACTTGTGGG + Intronic
957175861 3:76808673-76808695 ATGGAAAGTGGCTCAAATGTGGG + Intronic
958625059 3:96613110-96613132 CTGGCCAATGGCTCATTCTTTGG + Intergenic
959312742 3:104761284-104761306 CTGGAATCTGGATCATTTCTGGG - Intergenic
960703016 3:120455478-120455500 CTGGAAAATGAGTAATTTGGTGG + Intergenic
961212827 3:125139372-125139394 CTGGAAAGTGGCCCATGTGAGGG - Intronic
962358414 3:134714766-134714788 CAGGAGACTGGCTCATTTGGAGG - Intronic
963217335 3:142763098-142763120 CTGGAAAATGTTTCATGTGCTGG + Intronic
963360300 3:144264080-144264102 CAGGAGAATGGCACATGTGTGGG - Intergenic
963786114 3:149536087-149536109 TTGGAAAATGGATTATTTCTGGG + Intronic
964784370 3:160378536-160378558 GTGGAAAATGGCTGATTTGGGGG + Intronic
964922477 3:161914144-161914166 CTGGAAAATGACTCATTTCCTGG - Intergenic
965792465 3:172404465-172404487 CTGGAAAAGGTGCCATTTGTAGG + Intergenic
966358863 3:179111964-179111986 TTGGAAAATGTCCCATCTGTAGG + Intergenic
967368384 3:188714442-188714464 CTGCAAAATGGCTGATAGGTAGG - Intronic
967453707 3:189655923-189655945 ATGGATAATAGGTCATTTGTGGG - Intronic
967772459 3:193349143-193349165 CAGGAAACTGGCTCATTTTGTGG + Intronic
971014514 4:22473793-22473815 CTGAAGAATGGCTCATTTTCTGG - Exonic
971504877 4:27355674-27355696 CTGCAAAATGCTTCCTTTGTGGG + Intergenic
971559650 4:28061186-28061208 CTGGAACATGGATCATGAGTAGG - Intergenic
974032100 4:56785257-56785279 GGGGGAAATGGCTCATTTGTGGG + Intergenic
974339388 4:60594672-60594694 CTGGGAAATGACATATTTGTAGG + Intergenic
976408360 4:84684701-84684723 CTGGTAAATGGGTCACTTCTTGG + Intronic
979846543 4:125520358-125520380 CTGGAAAATTATTCATTTGCTGG - Intergenic
980160336 4:129153856-129153878 CTTTAAAATGCCTCATTGGTTGG - Intergenic
981322243 4:143406079-143406101 CTAGAAAATGGCTCAGTCCTGGG - Intronic
982645210 4:158015515-158015537 CTGGAAAAAGGCTGGTTTGTGGG + Intergenic
984585744 4:181562607-181562629 CTGGAAAGTGGCTATTTTGCTGG - Intergenic
985312501 4:188617408-188617430 CTGGAAAATGGAGCAATTCTTGG - Intergenic
987418528 5:17691005-17691027 CTTGAAGATGACACATTTGTAGG - Intergenic
988646982 5:33105516-33105538 CTGGAAAATGCCTCAGCAGTAGG - Intergenic
990836058 5:60021563-60021585 CAGGAAAATGACACATTTGAGGG + Intronic
991158727 5:63469634-63469656 CTGCAAAATGAATCATTTGATGG - Intergenic
991263245 5:64689201-64689223 ATGGTAAAAGGCTCCTTTGTTGG + Intergenic
992412614 5:76521518-76521540 TTGGAAAATGACTCACTTTTAGG + Intronic
995016708 5:107318175-107318197 CTGGAAAATAGAGCAGTTGTAGG + Intergenic
996178604 5:120390741-120390763 CCAGAAAGTGGCTCATCTGTAGG - Intergenic
997666237 5:135631581-135631603 CTGGAAAATTAGCCATTTGTTGG - Intergenic
997679874 5:135742768-135742790 CTTGAAAGTGCCTCATTTATTGG + Intergenic
998335061 5:141364445-141364467 CTGGACAAAGGCTCCTTCGTCGG + Exonic
998336150 5:141374198-141374220 CTGGAGAAAGGCTCCTTCGTAGG + Exonic
999684241 5:154088284-154088306 ATGGAAGATGTCTAATTTGTGGG + Intronic
999925599 5:156372723-156372745 CTTCAAAATGTCTAATTTGTAGG - Intronic
999962232 5:156768201-156768223 CTCAAAGATGGCTTATTTGTAGG - Intergenic
1000248976 5:159475463-159475485 CTGAAAAATTGTTCCTTTGTTGG + Intergenic
1004014562 6:11720256-11720278 CTGGAGAAAGGCTCACTAGTAGG + Intronic
1005639166 6:27778251-27778273 CTGGAAGATAGGTAATTTGTTGG - Intergenic
1007286786 6:40753629-40753651 TGGGAAAATGGCACATTGGTTGG + Intergenic
1008035641 6:46742302-46742324 CTGGACAAGGGCTCCTTGGTGGG + Intergenic
1008811631 6:55508080-55508102 CTGGAAGATGGCTGTTGTGTTGG - Intronic
1011764575 6:90606342-90606364 CTGGAAAATAACTCATCTTTAGG - Intergenic
1011871672 6:91902036-91902058 ATGGTAAATGGCTTATTTGAAGG + Intergenic
1013808922 6:114022530-114022552 CTGAAAATGGGGTCATTTGTGGG + Intergenic
1015000533 6:128209151-128209173 GTGGAAAATGGCGCGTTTTTAGG - Intronic
1015178376 6:130336247-130336269 CTAGAAAATATCTCATATGTGGG - Intronic
1017260891 6:152385403-152385425 CTAGGAAATGGCTAATTTGGTGG - Intronic
1024259117 7:47560660-47560682 CTGGAAAGGGGGTCATTTGTAGG - Intronic
1024585310 7:50836817-50836839 CTGGAAACTGGCACATGTGATGG - Intergenic
1029325992 7:99809180-99809202 CTTGAAAATGGATCATTTAAGGG + Intergenic
1029995043 7:104999567-104999589 CAGTAAAATCGGTCATTTGTGGG - Intergenic
1030208858 7:106976848-106976870 CTGGCTAATGGATCATTTCTAGG - Intergenic
1031437581 7:121751782-121751804 CTGAAAAGTGTCCCATTTGTTGG + Intergenic
1035603937 8:916759-916781 AAGGCAAATGGCTGATTTGTTGG + Intergenic
1036806912 8:11841378-11841400 CTGGGAAATGGCTCAGTAGATGG - Intergenic
1038686622 8:29724810-29724832 TGGGAAAATGGCTGATTTGGAGG - Intergenic
1038997633 8:32943193-32943215 CTGGAGAATGTCCCATTTGCTGG + Intergenic
1039123419 8:34174789-34174811 TTGGAACATGTCTCATTTCTAGG + Intergenic
1040393645 8:46973649-46973671 CTTGAAATTGGCTCATCCGTTGG + Intergenic
1046072746 8:109278322-109278344 TTGCAAAATGGCACAGTTGTGGG + Intronic
1046166968 8:110449682-110449704 CTGGAAAAGGGCTTGTCTGTGGG - Intergenic
1048131602 8:131703800-131703822 CTGGAAACTGGGGCATTTATAGG - Intergenic
1048173054 8:132126846-132126868 CTGGAAAATGCATCATCTATTGG + Exonic
1048353714 8:133636324-133636346 CTTGACAATGGTTCTTTTGTTGG + Intergenic
1048555099 8:135468294-135468316 GGGGAAAATGGCTCATTTGAGGG - Intronic
1050829134 9:9989642-9989664 CTGGAAAAGGGCACAGGTGTGGG + Intronic
1052778463 9:32756102-32756124 TTGGAAAATGCAACATTTGTGGG + Intergenic
1055045546 9:71920476-71920498 AAGGAAAATGGCCCATTTGGGGG - Intronic
1055568278 9:77590775-77590797 CTGAAAATTTGCTCATGTGTGGG - Intronic
1058141782 9:101364084-101364106 GTGGAGAATGGCTCCTGTGTAGG - Intronic
1058381813 9:104384963-104384985 CTGGAGAATGGCTCATGATTGGG + Intergenic
1061347828 9:130041952-130041974 CTGGGAAATGGCTCATCTTGAGG + Intronic
1186419793 X:9416252-9416274 CTGGCAAATATTTCATTTGTGGG - Intergenic
1187521741 X:20020296-20020318 CTGGAAAAATGCTCATGTCTCGG + Intronic
1190254447 X:48752141-48752163 CTGGACACTGGCTCCATTGTGGG - Intergenic
1190583141 X:51907903-51907925 CTGCAAAAGGGCTCACATGTGGG + Intergenic
1192091740 X:68166235-68166257 CTGGCCAATGGCTTATTTTTAGG - Intronic
1193684967 X:84566889-84566911 GTGGACAAAGGCTCTTTTGTTGG - Intergenic
1194589163 X:95775512-95775534 GTGGATAATGCCTCCTTTGTGGG + Intergenic
1195854515 X:109315758-109315780 CTGGCAAATGGCTAATATGGAGG - Intergenic
1196311904 X:114178120-114178142 CAGGAAAAAGGCTCTTTTGCTGG + Intergenic
1196529015 X:116761604-116761626 CTGTAAAATGGCTGAATTCTGGG - Intergenic
1198369600 X:135977218-135977240 ATGGAAAATGGCTCTTTCTTTGG - Intergenic
1199252210 X:145676267-145676289 CTGGACAATGGCTTCTTTCTGGG + Intergenic
1200932515 Y:8709903-8709925 CTGGCAAACTACTCATTTGTGGG - Intergenic
1201327588 Y:12780933-12780955 CTGGAAAATGGCTCATTTGTAGG - Intronic