ID: 1201327986

View in Genome Browser
Species Human (GRCh38)
Location Y:12786308-12786330
Sequence TGTTAGGTATAGAACTTGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201327986_1201327993 24 Left 1201327986 Y:12786308-12786330 CCTCCCAAGTTCTATACCTAACA 0: 1
1: 0
2: 2
3: 7
4: 105
Right 1201327993 Y:12786355-12786377 AATGTAATTTTTATATTATACGG 0: 1
1: 0
2: 10
3: 117
4: 1233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201327986 Original CRISPR TGTTAGGTATAGAACTTGGG AGG (reversed) Exonic
903008327 1:20312959-20312981 TGTTGGGGATCGAACATGGGAGG - Exonic
903114443 1:21167090-21167112 TGTAAGAAATAGAACTTGGTCGG - Intronic
903644940 1:24889512-24889534 TGCTAGATAAAGAACTTGGGTGG - Intergenic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
909400831 1:75228179-75228201 TATTAGGTATAAACCTTAGGAGG - Intronic
911292275 1:96071544-96071566 AGTTAGATTCAGAACTTGGGAGG + Intergenic
911412283 1:97524779-97524801 AGTTAGGGATAGAAATTTGGGGG - Intronic
912128475 1:106570749-106570771 TGTTAGTAGTAGAAATTGGGTGG - Intergenic
1065654582 10:27934951-27934973 TGTTAGGGAGAACACTTGGGAGG - Intronic
1072728567 10:97829748-97829770 TGGTAGGTATGGGACCTGGGAGG - Intergenic
1074880930 10:117657917-117657939 TGTTAATTGTAGAACATGGGTGG - Intergenic
1075317839 10:121466572-121466594 TGTTAGGCAGAGAAACTGGGGGG - Intergenic
1075862146 10:125686001-125686023 TGGTAGGGATAGAGCCTGGGGGG - Intergenic
1080066661 11:28023837-28023859 TGTTTGATGTAGAACTTGAGAGG + Exonic
1081929623 11:46859897-46859919 TGTTAAGGAGAAAACTTGGGAGG + Intronic
1085166831 11:74409194-74409216 TGGTAAGTCTTGAACTTGGGTGG + Intergenic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1088366715 11:109047557-109047579 AGTTAGGTACACAACTTTGGCGG - Intergenic
1088849515 11:113693528-113693550 TGTTTGTTATAAAACTTGGAGGG - Intronic
1089403838 11:118181273-118181295 TGTAAGGTAAATAACTAGGGAGG - Intergenic
1092471554 12:8786360-8786382 TGCTAGGTTTTGAACTTGGATGG - Intergenic
1095843098 12:46715876-46715898 TTTTAGGTATAAAACTTGTTTGG - Intergenic
1096116371 12:49057893-49057915 TCTTAGGTATAGGACTGAGGGGG - Intronic
1096448697 12:51719030-51719052 TTTTTGGTATATAACTTGGAAGG + Intronic
1097639344 12:62160748-62160770 TAATGGGTATAGAACGTGGGAGG - Intronic
1099516556 12:83603676-83603698 TGTTAATTACAGAAGTTGGGTGG + Intergenic
1099724184 12:86403679-86403701 TTTTAGGTATAGATTTTGGAAGG + Intronic
1101211328 12:102537995-102538017 TGTTAAGGAAATAACTTGGGAGG + Intergenic
1102720959 12:115015523-115015545 TTTTAGTTATGGAACTTTGGGGG - Intergenic
1103299102 12:119914045-119914067 TGTTAGGTAAAAACTTTGGGCGG + Intergenic
1105768148 13:23580642-23580664 TGAAAGGTATAGAACTGGAGGGG + Intronic
1106351034 13:28930838-28930860 TGTTACGTATAGGATTTGTGGGG + Intronic
1108939314 13:55932497-55932519 AGTTTGGGATAGCACTTGGGAGG - Intergenic
1120787856 14:88553276-88553298 TCTTATGGATAGATCTTGGGGGG - Intronic
1121707609 14:96010761-96010783 TGTTGGGTTTTGAACTTGCGTGG - Intergenic
1125755458 15:42061208-42061230 TCTTAGGATCAGAACTTGGGAGG - Intergenic
1126832900 15:52627142-52627164 TATCAGGTTTAGAATTTGGGTGG - Intronic
1137966609 16:52940442-52940464 TGTTAGGAACAGGACCTGGGAGG + Intergenic
1140400765 16:74669528-74669550 TGTTAGTTGTAGAATTTAGGTGG + Intergenic
1141417210 16:83884980-83885002 TGTTTGGTATATACCTTGGAGGG + Intergenic
1143426176 17:6840324-6840346 TGTAAGGTATATAACTTGCAGGG + Intergenic
1144466813 17:15503814-15503836 TGTTTGGGATAGAACTTCGGTGG - Intronic
1146704184 17:34988312-34988334 TGTTGGGGATGGAATTTGGGAGG + Intronic
1151676596 17:75601987-75602009 TGGTAGGCATAGAACTCGGAAGG - Intergenic
1156363147 18:36401770-36401792 TGTGAGGGATAGAACATGAGGGG - Intronic
1157537916 18:48474159-48474181 TGCTAGGTATTGAACTTGCTTGG + Intergenic
1159358572 18:67370035-67370057 TGTCAGATATAGAACTTCGGTGG + Intergenic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
924985760 2:268056-268078 TTTTAGGTCCAGATCTTGGGAGG + Intronic
926987422 2:18639751-18639773 TGTCAGCTGTAGAACGTGGGTGG + Intergenic
929617193 2:43320895-43320917 TTTTAAGTATAGAAATTTGGGGG + Intronic
931239822 2:60442206-60442228 AGTGAGGTATAGACCTTGAGTGG - Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
934169478 2:89327840-89327862 TGTTAGGTTTAAAAGTTGCGTGG - Intergenic
934197816 2:89854745-89854767 TGTTAGGTTTAAAAGTTGCGTGG + Intergenic
935828753 2:106977290-106977312 TGTTAGTCTTAGATCTTGGGAGG + Intergenic
936233357 2:110723771-110723793 TGTTACCAATAGAACTTTGGAGG - Intergenic
1172875204 20:38160011-38160033 TGTTAGCAAGAGAACTTTGGGGG + Intronic
1174547871 20:51339610-51339632 CGTAGGCTATAGAACTTGGGTGG - Intergenic
1175011123 20:55737455-55737477 TGTTAGGTATTAAACTTTGTAGG - Intergenic
1179878178 21:44281958-44281980 TGATGTGTATAGAAGTTGGGAGG - Intergenic
1182955956 22:34426650-34426672 TGTTAGGCTTAGTACCTGGGTGG + Intergenic
950244342 3:11401999-11402021 TGTTAAGTGTACAACTTGGTGGG + Intronic
959666730 3:108931301-108931323 TTTTAGGTACAGTACATGGGTGG + Intronic
959898049 3:111627472-111627494 TGTTGGCCATAGAACATGGGTGG - Intronic
961985192 3:131124502-131124524 TGTTAGGTAAAGGAAGTGGGGGG - Intronic
963080465 3:141388379-141388401 TATTATGTATATAATTTGGGGGG + Intronic
964585679 3:158297633-158297655 TGTGAGTTATAGAATCTGGGTGG + Intronic
964684519 3:159380421-159380443 TGTCATGTCTAGAATTTGGGTGG - Intronic
968177199 3:196561264-196561286 TGTGAGGCATAGAGCTTGGTGGG + Exonic
975694391 4:76997435-76997457 TGTCAGTTATGGAAGTTGGGGGG + Intronic
977362066 4:96017866-96017888 TGTTAGGTTTTGAACTTCTGGGG + Intergenic
978390582 4:108221114-108221136 TGATAATTATAAAACTTGGGTGG + Intergenic
987251866 5:16108488-16108510 TGGTGGGTACAGAACTTGGAAGG + Intronic
988128391 5:27073080-27073102 TGTTAGCTAGAGACCTTGGTGGG - Intronic
989604481 5:43230783-43230805 TGTGAGGTACAGAATTGGGGAGG - Intronic
989810412 5:45666008-45666030 TGTCAAGAAGAGAACTTGGGGGG - Intronic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
995659413 5:114464168-114464190 TTTTAGGTATAGGAAATGGGAGG + Intronic
995680289 5:114710063-114710085 TGATAGGTATAGAACTGGCTTGG - Intergenic
995737318 5:115315563-115315585 TATTTGGTCCAGAACTTGGGTGG + Intergenic
997575639 5:134974845-134974867 TGTTAGGTATAGGACTTGGCAGG + Intronic
997868032 5:137482077-137482099 TGTCGGGGATAGAAATTGGGAGG + Intronic
998713616 5:144854318-144854340 TTTTAGCTATAGAATTTGGTAGG + Intergenic
1012677639 6:102137351-102137373 TGCTAGGTTTCGAACTTGCGTGG - Intergenic
1018336994 6:162803074-162803096 TGTGGGGTAAACAACTTGGGGGG - Intronic
1018692312 6:166356920-166356942 TGTTAGGTACAGGAGGTGGGAGG - Intergenic
1021521003 7:21538806-21538828 TGTCGGCTATAGAACATGGGTGG + Intergenic
1025143076 7:56482032-56482054 TGTTGGGTATAAAAACTGGGGGG - Intergenic
1025258666 7:57402687-57402709 TGTTGGGTATAAAAATTGGGGGG - Intergenic
1025709784 7:63898699-63898721 TGTTGGGTATAAAACTTGGGCGG - Intergenic
1030930820 7:115521707-115521729 TGCTGGGTTTAGAACTTGTGTGG - Intergenic
1031580731 7:123471634-123471656 TGTTAGGCTAAAAACTTGGGGGG - Intronic
1031627245 7:124005088-124005110 TGTCAGTTAGAGAGCTTGGGTGG + Intergenic
1034502933 7:151462722-151462744 TGTTGGGTATAAAAGTTGGGGGG - Intergenic
1035603341 8:912298-912320 GGTTATGTATAAAAGTTGGGTGG + Intergenic
1037364120 8:18104249-18104271 TGCTGGGTATAGAACTTGCATGG + Intergenic
1044125796 8:88457049-88457071 TGTTGGCTAGAGAGCTTGGGTGG - Intergenic
1045243642 8:100424095-100424117 TTTTAGGTAGAGAACTAGGGAGG + Intergenic
1045301172 8:100911519-100911541 TATTGGGTATAGCACTTGGCTGG + Intergenic
1048084617 8:131163150-131163172 ACTTTGGTTTAGAACTTGGGTGG + Intergenic
1055127526 9:72735977-72735999 TCTTTGGTATAAAACTTGGTGGG + Intronic
1056122359 9:83502082-83502104 TTTTAGGTATGGACCTGGGGTGG + Intronic
1058200037 9:102027921-102027943 TGTCAGCTATAGAACATGGATGG + Intergenic
1061464681 9:130768294-130768316 TGCTAGGTCTGTAACTTGGGAGG + Intronic
1186498369 X:10031032-10031054 TGTTAAGAATAGAAGTTGGCTGG + Intronic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1189455451 X:41184103-41184125 TGTTAGATATAGCACTTGTGAGG - Exonic
1189661541 X:43305320-43305342 TTTTTGGTATATAACTTGGAAGG - Intergenic
1190407302 X:50100885-50100907 TGCTAGGAAAAGAGCTTGGGAGG - Intergenic
1193555034 X:82943294-82943316 TTTTAGATATAGAATTTGTGGGG + Intergenic
1194985118 X:100481774-100481796 TGTTAGATATATGACTTTGGAGG - Intergenic
1199748290 X:150790263-150790285 TGTTCTGTATGGTACTTGGGTGG + Intronic
1201298160 Y:12483031-12483053 TGTTAAAAATAGAAATTGGGCGG - Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic