ID: 1201327993

View in Genome Browser
Species Human (GRCh38)
Location Y:12786355-12786377
Sequence AATGTAATTTTTATATTATA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1361
Summary {0: 1, 1: 0, 2: 10, 3: 117, 4: 1233}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201327988_1201327993 20 Left 1201327988 Y:12786312-12786334 CCAAGTTCTATACCTAACAGAGG 0: 1
1: 0
2: 0
3: 14
4: 125
Right 1201327993 Y:12786355-12786377 AATGTAATTTTTATATTATACGG 0: 1
1: 0
2: 10
3: 117
4: 1233
1201327986_1201327993 24 Left 1201327986 Y:12786308-12786330 CCTCCCAAGTTCTATACCTAACA 0: 1
1: 0
2: 2
3: 7
4: 105
Right 1201327993 Y:12786355-12786377 AATGTAATTTTTATATTATACGG 0: 1
1: 0
2: 10
3: 117
4: 1233
1201327987_1201327993 21 Left 1201327987 Y:12786311-12786333 CCCAAGTTCTATACCTAACAGAG 0: 1
1: 0
2: 1
3: 12
4: 147
Right 1201327993 Y:12786355-12786377 AATGTAATTTTTATATTATACGG 0: 1
1: 0
2: 10
3: 117
4: 1233
1201327991_1201327993 8 Left 1201327991 Y:12786324-12786346 CCTAACAGAGGTTGGTTTTTGCC 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1201327993 Y:12786355-12786377 AATGTAATTTTTATATTATACGG 0: 1
1: 0
2: 10
3: 117
4: 1233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201327993 Original CRISPR AATGTAATTTTTATATTATA CGG Intronic
900663413 1:3797704-3797726 AATATAATTTTTATATTAACCGG + Intergenic
901366551 1:8755898-8755920 AATTTAATTTTTATTTTTTGTGG - Intronic
901504143 1:9673875-9673897 AATGTAATTATTACATAAGAGGG - Intronic
901893030 1:12284399-12284421 ATTATTATTTTTATATTACATGG + Intronic
902080481 1:13817325-13817347 AATCTGAGTTTTATATTTTATGG - Intronic
903101250 1:21031707-21031729 GATATACTTTTTATTTTATAGGG - Intronic
903783795 1:25842441-25842463 CCTGTACTTTTTATGTTATAGGG - Intronic
904846613 1:33423676-33423698 AAATTAATTTTTTTAGTATAGGG - Intronic
904894226 1:33802110-33802132 AATGTCAGATTAATATTATAAGG + Intronic
906000481 1:42420403-42420425 AATGTTCTTTTTATATACTATGG + Exonic
906053381 1:42893726-42893748 AGTGCAATTTTAATATAATATGG + Intergenic
906591388 1:47027655-47027677 AATGAAATTCTTATCTTGTAGGG - Intronic
906739303 1:48166369-48166391 ATTTCTATTTTTATATTATATGG - Intergenic
907075690 1:51576074-51576096 AATGTAAGTTTTATGTGACATGG - Intergenic
907210091 1:52813484-52813506 AATGTAATATGTATAGTAAATGG - Intronic
907784491 1:57598412-57598434 AGTGTCATTTCTATTTTATAAGG - Intronic
907884651 1:58581603-58581625 CATGTGAATTTTATATTAAAGGG + Intergenic
907951816 1:59190483-59190505 ATGGTAAATTTTATATTATGTGG + Intergenic
908508760 1:64833196-64833218 AATGAAATCTTAATATTAAAAGG + Exonic
908975338 1:69890205-69890227 AATGTATTTCTTAAATAATAAGG + Intronic
909037036 1:70605185-70605207 AATTTAATTTTTAATTTATGTGG + Intergenic
909038697 1:70624973-70624995 CATGTAATTTTTTTATTTTTTGG + Intergenic
909157668 1:72099834-72099856 ATTGAAATTTTTATTTTTTAAGG - Intronic
909184341 1:72466758-72466780 AATTCAATTTTTATATTAGTAGG + Intergenic
909330874 1:74409124-74409146 AATGTCTTTTCTATCTTATAGGG - Intronic
909472428 1:76043437-76043459 AATATAAATTTTAAAGTATATGG - Intergenic
909537440 1:76753512-76753534 AAAGTAAAATTCATATTATAAGG - Intergenic
909643907 1:77895351-77895373 AGTGTAATTTTTAAAGTATAAGG + Intronic
909865708 1:80667378-80667400 TATGTATTTTTTGTATCATAAGG - Intergenic
910144176 1:84059072-84059094 AAAGGTATTTTTATATTGTATGG - Intergenic
910234915 1:85025366-85025388 AATGTGATTTTTATTTTGTGGGG + Intronic
910607456 1:89102574-89102596 AATGAAACTTATGTATTATAAGG - Intergenic
910608481 1:89113713-89113735 AATGTATTTTTTAATTTAAAAGG + Intronic
910825239 1:91399872-91399894 AATGCAAATTTTGTAATATACGG - Intronic
910920138 1:92336325-92336347 AATGTAATTTTTAAATTTTCAGG + Exonic
910950433 1:92641400-92641422 AATGTAAATTATATAATACAGGG - Intronic
911276253 1:95862960-95862982 AATGTAAGTATTTTGTTATAAGG - Intergenic
911301874 1:96184463-96184485 AATTTAACTTTTATAACATATGG - Intergenic
911346565 1:96703606-96703628 ACTGTCATTTTTATATAACAAGG + Intergenic
911479797 1:98423796-98423818 TATATAATATTTATAATATATGG + Intergenic
911523295 1:98954188-98954210 AAACTTATTTTTCTATTATACGG + Intronic
911734101 1:101318415-101318437 AATAAAATTTTTACATGATATGG - Intergenic
911793035 1:102042566-102042588 AATGTGATTTTTAGAGAATAAGG - Intergenic
911906414 1:103574009-103574031 AATGCAATTTCTATAGGATAAGG + Intronic
911934498 1:103951518-103951540 AAAATAATTTTTGCATTATAAGG + Intergenic
911976216 1:104498699-104498721 AATTTAATTATTATATTTTTTGG - Intergenic
911984741 1:104608144-104608166 AATGTAATTTCTGAATTATATGG - Intergenic
912061900 1:105684423-105684445 AATTGAATTTTTATATTCCATGG + Intergenic
912732241 1:112118087-112118109 AATGTACTTTTTATATTTTATGG - Intergenic
912752324 1:112295518-112295540 GAATTAATTTTTATATTGTAGGG - Intergenic
912900524 1:113643082-113643104 AATATAATTTTTATTTTCCAAGG + Intronic
912915863 1:113813418-113813440 AAAGTATTTTTTAAATTATCTGG + Intergenic
913000514 1:114575836-114575858 TCTGTAGTTTTTATACTATATGG - Intronic
913010869 1:114682492-114682514 AATATGATTTTAATATTAAAAGG + Intronic
913379540 1:118194122-118194144 ATTTTTATTTTTATATTTTAGGG - Intergenic
913706599 1:121431022-121431044 AATGTAAAATTTATATGCTAGGG + Intergenic
915679714 1:157568995-157569017 AATGTTACTTTCATATTATATGG + Intergenic
915690465 1:157683894-157683916 ATAGTAATTTTAATATTACATGG - Intronic
916117995 1:161504430-161504452 AATGGAATTTTTAGGTGATAAGG + Intergenic
916188167 1:162152960-162152982 TATGTAATTTATGTATAATAAGG + Intronic
916561534 1:165937821-165937843 AAAGTAAATCTTATATAATACGG + Intergenic
916602548 1:166307073-166307095 AATGTAAATTTTATTTTGGATGG + Intergenic
916734318 1:167593983-167594005 AATGTAATCTTTATTTTGGATGG - Intergenic
916868959 1:168891416-168891438 AATGGAATTATTAGATTATTTGG - Intergenic
916907955 1:169309405-169309427 AATCTCATTTTCATACTATATGG + Intronic
918416527 1:184314250-184314272 TATGTATTTTGTATTTTATATGG + Intergenic
918499740 1:185180536-185180558 ATTGTTATTTTCATATTATCAGG - Intronic
919071763 1:192764779-192764801 ATTGCAATTTTTATTTAATATGG - Intergenic
919294530 1:195679081-195679103 AATGTAATTATTTTCTTATTTGG - Intergenic
919401343 1:197121297-197121319 AATGAAATTTTTGTACTATTGGG + Intronic
919719374 1:200815539-200815561 ACTGATATTTTTATATTTTAAGG + Exonic
920888313 1:209955993-209956015 AATATAATTATGATATAATATGG - Intronic
921376149 1:214475940-214475962 ATTGTTACTTTTATATCATAAGG - Intronic
921476103 1:215612332-215612354 AATATCATTTTTATTTTAAAAGG - Intronic
921756003 1:218856365-218856387 AATGTACTTTGTATATAAGAAGG + Intergenic
921892445 1:220366732-220366754 AATATAATTTTTATATTACTAGG - Intergenic
921918292 1:220638338-220638360 AATGGAATTTTCATAATGTAAGG - Intronic
921921098 1:220670501-220670523 AATGTAATTTTGATATGATTGGG - Intergenic
922114930 1:222603673-222603695 AAGGTAATCTTTATAATAAATGG - Intergenic
923050737 1:230389706-230389728 AACCTACTTTTTATATTATGGGG - Intronic
923671378 1:236044036-236044058 CATGAAATAATTATATTATACGG + Intronic
923759235 1:236825230-236825252 AATTTTATATTTATATTAAATGG - Intronic
923935715 1:238757509-238757531 AATGTATTCTTTTTCTTATAAGG - Intergenic
924055870 1:240123425-240123447 CATGTTGTTTTTAAATTATAGGG - Intronic
924124123 1:240832174-240832196 AATGTTATTTATATCTTATTGGG - Intronic
924203377 1:241684476-241684498 AACCTAAATTTTATATTAAATGG + Intronic
924413474 1:243832354-243832376 AATTTAATTCTTAAATTATGAGG - Intronic
924657878 1:245989889-245989911 AATTGAATTTTTATATCTTAAGG - Intronic
924957302 1:248941880-248941902 AATGTTATTTTTGGATTGTAAGG + Intergenic
1063269488 10:4490953-4490975 TATCTAATTTTTATAATGTATGG - Intergenic
1063341188 10:5264900-5264922 AATTTCATTTTTAGATTTTAGGG + Intergenic
1063360569 10:5452947-5452969 AATGTAATTTTTAAAAACTAGGG - Intronic
1063727749 10:8657053-8657075 AATGTATTTTTTATAAAAGAAGG - Intergenic
1064811359 10:19202503-19202525 AATGTAATAATAAAATTATAGGG - Intronic
1065039928 10:21682608-21682630 AATGTGAATTTTATTTTTTAGGG + Intronic
1065056766 10:21852453-21852475 AAGGTTAATTTTATGTTATATGG + Intronic
1065062452 10:21917850-21917872 AATGAAAATTTTATATTTAAAGG - Intronic
1065572534 10:27086162-27086184 TATTTAATTTTTATAATAAATGG - Intronic
1065750702 10:28884347-28884369 AATGTGATTTTTATTATATTTGG - Intergenic
1065911237 10:30307902-30307924 ACTGTAATGTTTATATTCTTTGG + Intergenic
1066193269 10:33075578-33075600 AATGTAATTGGTTTATTAAACGG + Intergenic
1066576087 10:36826419-36826441 AATGTTATTTTTGTACTATTGGG - Intergenic
1066930883 10:41756738-41756760 AATGTAATGTTTATATTTGCTGG - Intergenic
1067027116 10:42852913-42852935 ATTGTAAACTTTATATTAAAAGG - Intergenic
1068128849 10:52872489-52872511 AATGTAATTTGTATGTTCTTTGG + Intergenic
1068131475 10:52900776-52900798 AATGTAAGTTTCATGTTTTAGGG + Intergenic
1068139970 10:52993575-52993597 AATTTAACATTTATATTTTATGG - Intergenic
1068192049 10:53665265-53665287 TATATAATTTTTATATTATGAGG - Intergenic
1068297164 10:55087146-55087168 AATGTGATTTTTATATGGTGTGG + Intronic
1068299616 10:55121494-55121516 AATGTATTTTGTATATAAGAAGG + Intronic
1068753509 10:60623860-60623882 AATGTGATTTATATATGGTAGGG + Intronic
1068888656 10:62125435-62125457 AATGAAATTACTGTATTATATGG - Intergenic
1069105862 10:64382590-64382612 TCTGTAAGTTTTATATTTTATGG + Intergenic
1069151555 10:64967179-64967201 TCTGTTATTTTTATATTTTATGG - Intergenic
1069171300 10:65233076-65233098 AACTAAATTTTTATATTAAACGG - Intergenic
1069179886 10:65345180-65345202 ATTGAATTTTTTTTATTATAAGG + Intergenic
1069181283 10:65362268-65362290 AATGTAGTCTGTATATTTTAGGG + Intergenic
1069189845 10:65473432-65473454 AATGTATATTTTATATTGTATGG - Intergenic
1069217907 10:65845228-65845250 AATATAATTGTTAAATTATCCGG + Intergenic
1069237770 10:66099414-66099436 AATGTCATTTTATTATTATAAGG + Intronic
1069334913 10:67337055-67337077 AATGTATTTATTAAATAATAAGG - Intronic
1069449729 10:68506918-68506940 ACAGTAGGTTTTATATTATATGG - Intronic
1069529341 10:69204546-69204568 TATGTAATTTTTTTTTTAAAGGG - Intronic
1070117675 10:73544518-73544540 AATGTAATTGCTAGATCATACGG + Intronic
1070370114 10:75774391-75774413 AATGTCATTTTTATACTTTTTGG + Intronic
1071035690 10:81241521-81241543 AATGTAGCATTTATATTATAAGG + Intergenic
1071083992 10:81846876-81846898 ATTATAATTTTTATTTTATATGG - Intergenic
1071177823 10:82946774-82946796 GATTTAATTTATATATTAAAAGG + Intronic
1071316020 10:84399037-84399059 AATTTAATTTTTATATATTTTGG + Intronic
1071558579 10:86627052-86627074 AATGTAATTTTTATGTGGTTGGG + Intergenic
1071678394 10:87679581-87679603 CATGTAATTTTTAAAATATTTGG - Intronic
1071874677 10:89832232-89832254 AAAATAATTTTTATTTTTTATGG - Intergenic
1071895346 10:90060425-90060447 AATAGAAATTTTATTTTATATGG - Intergenic
1072177770 10:92945906-92945928 AAAGTAATTTTTGTATTTTTTGG + Intronic
1072262554 10:93694409-93694431 AGTTTCTTTTTTATATTATAAGG - Intronic
1072275976 10:93823869-93823891 AATGTAATTGCTGTATTGTATGG - Intergenic
1072498837 10:95991320-95991342 AATGTATTGTTTATATTTTAAGG - Intronic
1072813582 10:98483022-98483044 AATATAATGTATATATTTTATGG + Intronic
1073168503 10:101480402-101480424 AAACTAATTTTTTTCTTATAGGG + Intronic
1073383780 10:103104382-103104404 AAAGGAATTTTTGTATTATAAGG - Intronic
1073605434 10:104890990-104891012 ACTGTGATTTTTATCTTATTGGG + Intronic
1074520387 10:114215707-114215729 ACTGTAAATTTTATCCTATATGG - Intronic
1074802357 10:117013710-117013732 AATGTATTTCTAATTTTATAAGG - Intronic
1075110257 10:119573708-119573730 AAGTTAATTTATATTTTATAGGG - Exonic
1076963205 10:133783724-133783746 AATGTTATTTTTGGATTGTAAGG + Intergenic
1077616830 11:3681444-3681466 AATGTATTTCTTAAATAATAAGG + Intronic
1077626025 11:3772230-3772252 TATTTTATTTTTATATTTTAGGG - Intronic
1078753957 11:14191140-14191162 AATGTATTTTTTAAATGATGTGG - Intronic
1078778710 11:14417091-14417113 CATGTAATTTATATTTTAGAGGG + Intergenic
1078980807 11:16531515-16531537 AATGTAATATTTATTCCATAGGG - Intronic
1078995203 11:16690495-16690517 AATCTAGTTTTAATAGTATAAGG + Intronic
1079206100 11:18415998-18416020 AATTAACTTTTTAAATTATATGG - Intronic
1079325790 11:19490854-19490876 AATGTATTTTTGAAATAATAAGG + Intronic
1079425724 11:20340630-20340652 AATGTAAATTTTATGTGACAAGG - Intergenic
1079542083 11:21588733-21588755 AATATAATTTTTAAATTATGGGG + Intergenic
1079709953 11:23669454-23669476 AATGTTATTTTAATAATAAATGG + Intergenic
1079762403 11:24345688-24345710 AATGTAACTTTGGTTTTATATGG - Intergenic
1079796657 11:24812156-24812178 TATGTATTTTTTATGTTATGAGG + Intronic
1079941807 11:26689917-26689939 AATTTAATTATTATAATGTAAGG + Intronic
1080070203 11:28074217-28074239 TATATAATTCTTATATAATATGG + Intronic
1080157942 11:29134934-29134956 ATTGTTATTTTACTATTATAAGG + Intergenic
1080176838 11:29373584-29373606 AATGGTATTTATATAATATAGGG - Intergenic
1080326185 11:31076348-31076370 AATTTAATTTTTATTTTTTGAGG + Intronic
1080369403 11:31617556-31617578 ATAGTAAATTTTATGTTATATGG + Intronic
1080616934 11:33952806-33952828 AATGTAAATTTTTTTTTAAATGG + Intergenic
1080801815 11:35617318-35617340 AATGTGATTTTTCAATTAAAAGG - Intergenic
1081062115 11:38492327-38492349 AATGTAATTTTTATATTGAGTGG - Intergenic
1081368379 11:42265434-42265456 AATGTAAGTTTTATGTGACATGG - Intergenic
1081369960 11:42288104-42288126 AATGTGATTGTTGGATTATATGG - Intergenic
1081398175 11:42611894-42611916 AATGTCATTTCCATTTTATAAGG + Intergenic
1081475967 11:43431554-43431576 AATGTAATCTTTTTAAAATAAGG - Intronic
1081921146 11:46778626-46778648 AATGAAATTTATATAGGATATGG + Intronic
1081944255 11:46974966-46974988 ATTTTAATATTTATTTTATAAGG - Intronic
1082207089 11:49450424-49450446 AATGTAATTTTGATGACATAAGG - Intergenic
1082653298 11:55821346-55821368 ACTGAAATTTTAATATGATATGG + Intergenic
1082687533 11:56259310-56259332 AATGTATTTTTTATGTGAGAAGG - Intergenic
1082709190 11:56532815-56532837 AATGTAATTTTTTTTTTAGTTGG - Intergenic
1082751139 11:57019081-57019103 AATTTAATTTTTCTACAATAAGG + Intergenic
1085439023 11:76540653-76540675 AATGCCATTTATGTATTATAAGG - Intronic
1085677693 11:78540048-78540070 AACGTAAGTTTTATATGATCAGG - Intronic
1085888623 11:80551078-80551100 TATGTAAATTTTATATCAAAAGG + Intergenic
1085915133 11:80878034-80878056 AATCAAATTGTTATATCATAGGG - Intergenic
1085921341 11:80961248-80961270 AATGAAATATTTATAATAGAAGG + Intergenic
1085989376 11:81822814-81822836 CTTGTAATTTTTATCTGATAGGG + Intergenic
1086139426 11:83478640-83478662 AATGTGATTTTTATAAGAAAAGG + Intronic
1086211456 11:84325154-84325176 TATCTGATTTTTATATTGTAAGG + Intronic
1086238213 11:84657954-84657976 AATGTCATCTTTATTATATATGG - Intronic
1086310929 11:85536052-85536074 AGTCTAATTTTTATATTTTTTGG - Intronic
1086319553 11:85630365-85630387 ATTTTAATGTTTATATTAAAGGG - Intronic
1086415244 11:86582683-86582705 TATGCAGTTTTTATATTTTAAGG - Intronic
1086648185 11:89251313-89251335 AATGTAATTTTGATGACATAAGG + Intronic
1086798548 11:91140951-91140973 ACAGTAATTTTCATATTTTAAGG - Intergenic
1087056088 11:93937941-93937963 CATGTAGTTTTTATTTTATAAGG - Intergenic
1087112464 11:94485275-94485297 GATGATATTTTTATAATATAGGG + Intronic
1087363312 11:97188000-97188022 AATGTAATTTTGTTATCATCTGG - Intergenic
1087387733 11:97493312-97493334 AAATTAATTTTTCTATTGTAAGG + Intergenic
1087397408 11:97617730-97617752 AATATACTTTTGATATTATATGG - Intergenic
1087421597 11:97933483-97933505 AAATTATTTTTTATATTACATGG + Intergenic
1087471123 11:98575617-98575639 AATGCATTTTTTATGTAATATGG - Intergenic
1087508315 11:99056907-99056929 AATGTAACTTTTCTTTTATTTGG + Intronic
1087879302 11:103396040-103396062 AATGTATGTTTTCTATGATAAGG - Intronic
1087884969 11:103469533-103469555 CATTTGATTTTTATTTTATAAGG - Intronic
1088036844 11:105327691-105327713 AAAGTAATTTTCTGATTATACGG + Intergenic
1088319600 11:108541880-108541902 AATGTACTTTTTTTTTGATATGG + Intronic
1088352456 11:108905424-108905446 AATGTCATTAAAATATTATATGG + Intronic
1088502871 11:110500445-110500467 AATGGAATTTTTGGATCATATGG + Intergenic
1088715400 11:112544420-112544442 AATGTATTTTTAATTTTTTAAGG + Intergenic
1089879663 11:121761684-121761706 AATGTAATTTTATTATGACATGG + Intergenic
1089898181 11:121953443-121953465 ATAGTATTTCTTATATTATAGGG + Intergenic
1090110488 11:123902521-123902543 AATGTATTTTACATATTATAAGG - Intergenic
1090584945 11:128201471-128201493 AACTTAATTATTATATTATAGGG - Intergenic
1090675683 11:128993224-128993246 AAAAAAATTTTTATTTTATATGG + Intronic
1091102039 11:132883759-132883781 AGAATAATTTTTATTTTATAGGG - Intronic
1091199723 11:133765792-133765814 ATTTTAATTTTTAATTTATATGG - Intergenic
1091412004 12:247831-247853 AATGAAATTGTAATATTTTAAGG + Intronic
1091926481 12:4355204-4355226 AATTTGCTTTTTATAGTATAAGG + Intergenic
1092567161 12:9679038-9679060 AATTAGATTTTTTTATTATAAGG - Intronic
1092691798 12:11119893-11119915 AATGTAACTTTTATATTTTATGG + Intronic
1093107405 12:15105247-15105269 ACTGTACTTTTTATCTTATCGGG + Intergenic
1093246242 12:16740810-16740832 AATGTATTTTATATACTGTATGG + Intergenic
1093421912 12:18983523-18983545 AGTATATGTTTTATATTATAAGG - Intergenic
1093425177 12:19020583-19020605 AATGTAAAATTTATGTGATATGG - Intergenic
1093428541 12:19057005-19057027 AATGTAATTTTTTTTTTTTTTGG - Intergenic
1093606797 12:21101379-21101401 AATGTTAGTTTTATTTTATATGG + Intronic
1093679457 12:21984279-21984301 ATTGTAATTTATATATTGTCAGG - Intergenic
1093707862 12:22295377-22295399 AATGTAAGTTTTACAGGATATGG + Intronic
1093716972 12:22393649-22393671 AAAGTAACTTTTATACCATAGGG + Intronic
1093785092 12:23183706-23183728 AATGTAATATTTAGGTAATAAGG + Intergenic
1094084641 12:26576346-26576368 AACGTAATTTTTATTTTAAAAGG - Intronic
1094097674 12:26726028-26726050 CATGTAATTGTGGTATTATAAGG + Intronic
1094114722 12:26898722-26898744 AAAGTTATTTTTATAATGTAAGG - Intergenic
1094373568 12:29765513-29765535 ATTGTATATTTTTTATTATAGGG - Intronic
1094406087 12:30117674-30117696 AATTTAATTTTTTTTTTTTAGGG + Intergenic
1094437492 12:30437068-30437090 GATGTCATTTTTATTTTACATGG - Intergenic
1094743089 12:33311791-33311813 AATGTGATTCCTAGATTATATGG - Intergenic
1095175164 12:39083738-39083760 AATGAAACCTTTATATTATTTGG + Intergenic
1095210336 12:39486491-39486513 AATGGAATATATATATAATATGG - Intergenic
1095253834 12:40010392-40010414 AATGGCATTTATATATTTTAGGG - Intronic
1095278663 12:40323355-40323377 AATCTATTTTCTAAATTATAAGG - Intronic
1095337644 12:41048018-41048040 AAGGGAATAATTATATTATATGG - Intronic
1095408640 12:41896724-41896746 ATTTTAATTTTTAAATTATTTGG - Intergenic
1095520996 12:43065817-43065839 TATGTAATTTATATATAAAATGG - Intergenic
1095533764 12:43222110-43222132 AAGGTAATTTTTATATTAGCTGG - Intergenic
1095620139 12:44243405-44243427 AATCTAATTTTTACATTTTCAGG - Intronic
1095758166 12:45794811-45794833 AATCTAATTTATAAATTATGTGG + Intronic
1095823284 12:46504556-46504578 AAGGTAAATTTTATGTTACATGG - Intergenic
1095900873 12:47326822-47326844 AATGTATATTATATATTATATGG + Intergenic
1096285767 12:50298892-50298914 ATTGTACTTTTTATATTCTCAGG - Intergenic
1096858443 12:54503944-54503966 AATATATTTTTTATATTAATTGG + Intronic
1096891023 12:54771240-54771262 AAAATAACTTTTCTATTATAGGG + Intergenic
1096932927 12:55235717-55235739 AAGTTAATTTTTATACTATTAGG - Intergenic
1097255189 12:57668324-57668346 AGTGTAATTAATAAATTATAAGG - Intergenic
1097342756 12:58457656-58457678 AATTTAATTTTTTTTTTGTAGGG + Intergenic
1097497197 12:60355119-60355141 AATGTAATATCAATATTATTTGG + Intergenic
1097990980 12:65833681-65833703 AATGGCAGTTTTATTTTATATGG + Intronic
1098427123 12:70377353-70377375 AATGTAATTTTTATATGTACTGG - Intronic
1098591133 12:72214739-72214761 AATTTAAGTTTTGTCTTATAGGG - Intronic
1098612808 12:72482449-72482471 ATTATTATTTTTATATTACATGG + Intronic
1098621202 12:72601822-72601844 AATGTAATTTTTATATACACTGG + Intronic
1098635102 12:72773921-72773943 CATGTAATATTTGTATTATGAGG + Intergenic
1098705225 12:73678462-73678484 AATCTAATTTTTATAGGCTAAGG + Intergenic
1098711015 12:73761821-73761843 AATATAATTTCTGGATTATATGG + Intergenic
1098778793 12:74656796-74656818 AAGGGAATTTTTATAGTATATGG + Intergenic
1098817320 12:75183760-75183782 AATTTTATTTTCATATTCTAGGG - Intronic
1098856583 12:75659468-75659490 GATATAATTTTCATAGTATATGG + Intergenic
1099135499 12:78893794-78893816 AGTTTAATGTTTATTTTATACGG + Intronic
1099201652 12:79685145-79685167 ATTGAAATTTTAATATTATCAGG - Intronic
1099287586 12:80733725-80733747 ATTGTAATTTTTAAATTTTTTGG - Intergenic
1099352142 12:81586711-81586733 AAAATAATGTATATATTATAAGG + Intronic
1099498312 12:83379666-83379688 AATATAAACTTTATATTATTAGG + Intergenic
1099561519 12:84182291-84182313 AATATATTCTGTATATTATAAGG - Intergenic
1099562920 12:84201934-84201956 AACATAATAATTATATTATATGG + Intergenic
1099618710 12:84974084-84974106 AATTTAATATTTACATTATCTGG + Intergenic
1099642110 12:85303731-85303753 AATGAACTTTTGATATAATAGGG + Intergenic
1099776053 12:87132499-87132521 AATATATATTTTATATTATTAGG - Intergenic
1099897161 12:88662621-88662643 AATATAATTTATATAGTAAAAGG - Intergenic
1099899330 12:88688408-88688430 AATTGAATTGTTAGATTATATGG - Intergenic
1100003808 12:89869566-89869588 AATGTCATTTCCATATTATTTGG + Intergenic
1100017799 12:90032849-90032871 AATGTTATTCTTATTTTATTTGG + Intergenic
1100397996 12:94201429-94201451 ATTATTATTATTATATTATATGG - Intronic
1100506206 12:95223155-95223177 ACTGTTATTTTTATTTAATATGG - Intronic
1100633593 12:96412804-96412826 AATTAATATTTTATATTATATGG - Intergenic
1100730819 12:97466015-97466037 AAAGTAATATTTATTTTATGTGG + Intergenic
1100914263 12:99400742-99400764 AATGTAAACTTTTTATAATAAGG + Intronic
1102125994 12:110481288-110481310 AGTGGAATTATTAGATTATATGG + Intronic
1102661556 12:114533241-114533263 AATCTAATTGTTATATTCAATGG + Intergenic
1102666133 12:114574757-114574779 AATCTAATTGTTATATTCAATGG - Intergenic
1104082954 12:125447454-125447476 AATGGAATTAACATATTATAAGG - Intronic
1104191376 12:126485046-126485068 ACTTTAATTTATTTATTATAAGG - Intergenic
1104238685 12:126965053-126965075 AATCTAATTTTTTTTTTAAATGG + Intergenic
1104471171 12:129030859-129030881 AATATTGTTTTTATATTATAGGG - Intergenic
1104766285 12:131332580-131332602 AAGTTAATTCTTATATCATATGG - Intergenic
1104813118 12:131630017-131630039 AAGTTAATTCTTATATCATATGG + Intergenic
1105074464 12:133263428-133263450 AATGTGATTTTTGGATTGTAAGG + Intergenic
1105134310 13:16996869-16996891 AATGTTCTTTTTGTAGTATATGG + Intergenic
1105650007 13:22366849-22366871 AATGTAATATTTATGGGATACGG - Intergenic
1105657088 13:22453422-22453444 AATGTAAATTATACATTAAATGG - Intergenic
1106442939 13:29795357-29795379 TATATATTTTTTATATTATTAGG - Intronic
1106928425 13:34637215-34637237 TATGTAATTTTAATAAAATATGG + Intergenic
1107127890 13:36864216-36864238 AATGTAATTTTTATCCCAAAGGG - Intronic
1107401292 13:40072045-40072067 GCTGTAATTTTTGTATTACAAGG + Intergenic
1107499554 13:40959111-40959133 AATTTAATTTTTAGATCATCAGG + Intronic
1107747825 13:43530827-43530849 AATGTAATTTTTTTCTTAAAAGG - Intronic
1107794222 13:44033392-44033414 AAGGCAATTTTTAAATTGTATGG + Intergenic
1107797842 13:44072323-44072345 AATATAATTTTTATATAATTGGG - Intergenic
1108061046 13:46533852-46533874 ATTGTATATTTTATATTGTATGG + Intergenic
1108231115 13:48342387-48342409 CATTCAAATTTTATATTATAAGG - Intronic
1108494654 13:51012767-51012789 AATTAAATTTTTATATGTTAAGG - Intergenic
1108736566 13:53290092-53290114 AATGTATTTTTTCTATTAAAAGG + Intergenic
1108872994 13:55009405-55009427 AAAGTGATTTTTATAATAAATGG + Intergenic
1109091345 13:58050490-58050512 ATTTTAATTTTTTTATTTTAGGG - Intergenic
1109295829 13:60529761-60529783 ATTTTTAGTTTTATATTATATGG + Intronic
1109342422 13:61077824-61077846 CATGTAATTTTAATATTCAATGG - Intergenic
1109349144 13:61154604-61154626 AATGAAATGTTTATATTCAATGG - Intergenic
1109406907 13:61912264-61912286 AATATGCTTTTTATCTTATAGGG + Intergenic
1109447823 13:62467388-62467410 AATTTATTTTTTTTATTTTAAGG + Intergenic
1109680290 13:65742956-65742978 TATGGGATTTTTATATTTTATGG + Intergenic
1109701505 13:66030992-66031014 AATGTTATTTTTCTATTGTCAGG - Intergenic
1109775833 13:67039912-67039934 AATTTGATTTTTATAGTACACGG - Intronic
1109889773 13:68595213-68595235 AAATACATTTTTATATTATATGG + Intergenic
1110128264 13:71975595-71975617 AGTGTGATTTCTAGATTATATGG + Intergenic
1110205283 13:72904782-72904804 AGTGTATTTTCTATATTATGTGG - Intronic
1110570837 13:77001303-77001325 AATGTATTTTTTATTTTTGAAGG - Exonic
1110713655 13:78677249-78677271 CATGTAATTTTTATCGTAAAAGG - Intergenic
1110737523 13:78954717-78954739 AATGTATTTCTTAAATTATAAGG + Intergenic
1110743888 13:79030332-79030354 AAGATAATTTTTAAATTCTAGGG - Intergenic
1110879211 13:80550289-80550311 TATGTAATTTTTACCTTATTAGG - Intergenic
1110918543 13:81055063-81055085 AATGGAATTTCTGTATCATAGGG - Intergenic
1110953789 13:81526726-81526748 AATATAATATTCATGTTATATGG + Intergenic
1110957954 13:81580114-81580136 AATGTAAATAATATATTATGTGG + Intergenic
1111283462 13:86057835-86057857 TATGTAATTTTTATAGTAAATGG - Intergenic
1111367371 13:87267635-87267657 AATTGAATTTTTATTTAATATGG + Intergenic
1111520697 13:89399398-89399420 AGTGGAATTTTTAGATTAGACGG + Intergenic
1111615787 13:90659903-90659925 AAAGTAATTTATATATTCAATGG + Intergenic
1111710706 13:91809640-91809662 AATTCAATTATTATATTCTAAGG - Intronic
1111870334 13:93824066-93824088 AATGTATTTTTTAGATTTTGAGG - Intronic
1112263896 13:97904754-97904776 AATGTAATTTTTATAAGTTTTGG - Intergenic
1112401781 13:99084959-99084981 GATTTAATTTTTCTATTTTAGGG - Intronic
1112670202 13:101626826-101626848 AATGTTGTTTTCATATTTTAAGG - Intronic
1113100461 13:106712207-106712229 AATGCAATTATTAGATTATGTGG + Intergenic
1113325437 13:109277076-109277098 AATGTAAGTTTTATGTAACATGG - Intergenic
1113674938 13:112200690-112200712 AATGTTATTCTTATTTTTTAAGG + Intergenic
1113989629 13:114350565-114350587 AATGTGATTTTTGGATTGTAAGG + Intergenic
1114397807 14:22382910-22382932 AATTTCATTTTTATAGAATAAGG - Intergenic
1114480082 14:23027725-23027747 AAGGTAGTTATTATAATATAAGG - Intronic
1114820887 14:26018144-26018166 AATTTAATTTTTAATTTTTATGG - Intergenic
1114989953 14:28273892-28273914 AGTGAAATTTTTAGGTTATACGG - Intergenic
1115023015 14:28706065-28706087 AATATCATTTTTTTCTTATAAGG - Intergenic
1115026231 14:28749989-28750011 AAACTCAGTTTTATATTATAGGG + Intergenic
1115044531 14:28975146-28975168 AATGTAAGTTTTATAAAATAAGG - Intergenic
1115054292 14:29103809-29103831 ATTTTATTTTTTATATCATAAGG - Intergenic
1115415931 14:33133735-33133757 AATGTAGTTTCTATCTTATGTGG + Intronic
1115487011 14:33920744-33920766 AAAGTTATGTTTATACTATACGG - Intergenic
1115891485 14:38034426-38034448 AATGTATTTCTTAAATAATAAGG + Intronic
1115988213 14:39124766-39124788 TATGTAATTTTTTTTTTAGATGG - Intronic
1116114625 14:40630901-40630923 AAAGTAAATTTTATTTTGTAGGG + Intergenic
1116126116 14:40786959-40786981 AATTTAATCATTAGATTATATGG + Intergenic
1116144714 14:41049677-41049699 ATTGTAATTTTTAAAATATAAGG - Intergenic
1116432574 14:44864112-44864134 AATGTAATGTGGATATTAAATGG - Intergenic
1116479101 14:45376293-45376315 AAAGTAATTTTTAAATACTATGG + Intergenic
1116537388 14:46049446-46049468 AAAGCAATTTTTATGATATAAGG - Intergenic
1116606993 14:47012847-47012869 AATGTAATTTTTATATGCACAGG - Intronic
1116646699 14:47537962-47537984 AATGTATTATTTATATGATAAGG + Intronic
1116663216 14:47738968-47738990 AATATAATTTCTATTTTAAAAGG + Intergenic
1116666632 14:47784497-47784519 AATGTAAATGCTATATTATAAGG - Intergenic
1116689445 14:48085965-48085987 AATATAATTTTTAAAGTATTTGG - Intergenic
1116926567 14:50644610-50644632 AATGTAAATTTTGAAATATAAGG + Intronic
1117330817 14:54710269-54710291 AATTTACTTTTTATCTTCTATGG - Intronic
1117503832 14:56380909-56380931 AATGTAATTTTTTTATTCCAAGG + Intergenic
1117603458 14:57399224-57399246 AATATAATTGGTATATTAAAAGG - Intronic
1118205876 14:63723043-63723065 AATTTAATTTTTAAATAATATGG - Intronic
1119017094 14:71069616-71069638 AAAGTTATGTTTACATTATATGG + Intronic
1119403894 14:74383718-74383740 AATGTAAATTTTTTATTGAAAGG + Intergenic
1119517228 14:75257822-75257844 AATGTAACTTTTGAATGATAAGG - Intronic
1119679481 14:76581379-76581401 AATATAATCTTTACATTTTACGG + Intergenic
1120020104 14:79520054-79520076 AATGTTATTTTTATTTCATTTGG + Intronic
1120196539 14:81490310-81490332 AATGAATTTGTTATATTAAAGGG - Intronic
1120281596 14:82445585-82445607 TGTGTAACTTTTATATTTTAAGG + Intergenic
1120346850 14:83301523-83301545 AATGTCATTTTTTAATTATGTGG - Intergenic
1120475064 14:84976676-84976698 ACTGTAAATTGTAAATTATACGG - Intergenic
1120660760 14:87248428-87248450 AATGTAATTTTTTTCTCATATGG - Intergenic
1121385884 14:93524794-93524816 GGTATAATTTTTATATTATGAGG + Intronic
1121644123 14:95506313-95506335 AATGTGATTTTTTTCTTTTATGG - Intergenic
1122359189 14:101149063-101149085 AAAGTAATTTTTATTTTGTCAGG - Intergenic
1122927068 14:104909120-104909142 CAGGTAATTTTTATATTTTTTGG - Intergenic
1123192449 14:106584208-106584230 ACTGTTATTTTTAAATCATATGG + Intergenic
1202873363 14_GL000225v1_random:185813-185835 TATGTATATTTTATAGTATAGGG + Intergenic
1123426735 15:20177433-20177455 ATTGTAAACTTTATATTAAAAGG - Intergenic
1123535966 15:21183960-21183982 ATTGTAAACTTTATATTAAAAGG - Intergenic
1123585632 15:21758661-21758683 AAAGTAATTTTTTTATAAGATGG + Intergenic
1123725536 15:23097673-23097695 AACGTAATTTATAGATTAAATGG + Intergenic
1123753327 15:23375386-23375408 AATTCAATTATTATATTCTAAGG + Intergenic
1123854164 15:24390153-24390175 AATCAATTATTTATATTATATGG + Intergenic
1123968982 15:25486902-25486924 AATGTAATTTTTAAGATATGTGG - Intergenic
1124079595 15:26479197-26479219 AATGTGATTTGTCTAATATAGGG - Intergenic
1125207341 15:37168882-37168904 AGTGGAATTTTTAGGTTATAGGG - Intergenic
1125372661 15:38995108-38995130 AATTTGTTTTATATATTATAGGG + Intergenic
1125878579 15:43171374-43171396 AATGGAAGTTTTATATCATCAGG - Intronic
1125986946 15:44062819-44062841 ACTGTAATTTTTTTTGTATAAGG + Intronic
1126203594 15:46017704-46017726 AATTTAATTTATATAGTAGAAGG + Intergenic
1126271854 15:46828547-46828569 TATTTAATTTTGTTATTATAAGG + Intergenic
1126327121 15:47491070-47491092 TGTGTAATTTTTAGATCATAGGG - Intronic
1126390335 15:48142448-48142470 ACTGTAAGTTTTAGATTCTAAGG - Exonic
1126441927 15:48698731-48698753 TATGTAATTTTTATATGTCAGGG + Intergenic
1126470884 15:49009541-49009563 AATTTAATTTTTGTAGTGTATGG - Intronic
1126496397 15:49295436-49295458 AATCTAATTATTATATCATTTGG - Intronic
1126806624 15:52356433-52356455 AATGTCATTATAATTTTATATGG + Intronic
1127032885 15:54883409-54883431 AATGTATTTTTTATCTTTGAGGG - Intergenic
1127165089 15:56236562-56236584 AATGTTCTTTGTAAATTATAAGG - Intronic
1127212961 15:56793920-56793942 CATGGTATTTTTCTATTATATGG + Intronic
1127400279 15:58578460-58578482 AATCTAACATTTCTATTATATGG + Intergenic
1127444623 15:59048077-59048099 AATGTAATTTCTAGGTTCTATGG - Intronic
1127721367 15:61703275-61703297 AATGTAATTTTTATTTTTTGTGG - Intergenic
1127721916 15:61710932-61710954 AATGCAAATTTTAAACTATAGGG + Intergenic
1128032784 15:64496558-64496580 AAAATAATTTTTCTATTATGAGG - Intronic
1128296863 15:66528598-66528620 AATTTAATTTTTTTTTTACATGG + Intronic
1128825216 15:70709218-70709240 AATTTACTTGTTATAATATATGG - Intronic
1129084209 15:73071468-73071490 AATGTAATTTATGTATGATGGGG + Intronic
1129488092 15:75895997-75896019 ACTGAAATATTTCTATTATATGG - Intronic
1130028643 15:80292627-80292649 TATGTAATTTTTATAGTAATAGG - Intergenic
1130199701 15:81813559-81813581 AGCGCTATTTTTATATTATATGG + Intergenic
1130399734 15:83538756-83538778 AATGTAATTATTAATTAATATGG + Intronic
1130626328 15:85519272-85519294 CATGTAATTTTCACATTAAAAGG + Intronic
1131031474 15:89189495-89189517 AATTTATTTTTTATATTTTAGGG - Intronic
1131690237 15:94819413-94819435 AATCTAATTTTTATTATATTTGG + Intergenic
1131707224 15:95010765-95010787 AATTTAATATTAATATTGTAGGG - Intergenic
1131744257 15:95429185-95429207 AATGAAATTATACTATTATAAGG - Intergenic
1132332335 15:101021515-101021537 AATGTTATATTAATATTAAAGGG + Intronic
1133691032 16:8215443-8215465 ACTTTAATTATCATATTATATGG + Intergenic
1133780206 16:8932944-8932966 AATGGAATTTTTTTTTTTTATGG + Intronic
1134258071 16:12627659-12627681 ACTGTAATTTTTATTTTAGTAGG - Intergenic
1134464554 16:14463328-14463350 AAGGTAAAATTTATAATATATGG + Intronic
1134669273 16:16042721-16042743 AAAGTAGTCTTTATCTTATAGGG - Intronic
1135636799 16:24084561-24084583 AATGTAATTCTTTTATTGAAGGG - Intronic
1135912191 16:26571589-26571611 AATGTATTTTGTATATGAGAAGG - Intergenic
1136614479 16:31389049-31389071 AAATTAATTTTTATATCATCAGG - Intergenic
1136857511 16:33672068-33672090 ATTGTAAACTTTATATTAAAAGG + Intergenic
1136945524 16:34646159-34646181 AATATTATTTTTATTTTATTTGG - Intergenic
1137449607 16:48559004-48559026 TATGTATTTTTTAAAATATAAGG - Intronic
1137465909 16:48709276-48709298 AATGTATTTCTTAAATAATAAGG - Intergenic
1137776527 16:51059440-51059462 AAAGTAGTGTTTATATCATAAGG - Intergenic
1137820792 16:51443615-51443637 AAAGCAATTTTCAAATTATAAGG - Intergenic
1138011383 16:53383952-53383974 AATATAATTTTTATATCTTCAGG + Intergenic
1138637678 16:58354853-58354875 AATGTTATTGGTATTTTATAGGG + Intronic
1138861115 16:60758796-60758818 AATATAAATTTTACATGATATGG - Intergenic
1139019735 16:62732874-62732896 AATGTTACTTTTATTTTAGATGG + Intergenic
1139181678 16:64755577-64755599 AGTGTAATTTCTGTTTTATAAGG + Intergenic
1139204532 16:65014459-65014481 AATGTACATTTTATATTTAAAGG + Intronic
1140397503 16:74641061-74641083 AATGGAATTGCTTTATTATAGGG - Intronic
1140950414 16:79811648-79811670 AGTGTAATTTTTATACAAAATGG + Intergenic
1142439761 16:90089325-90089347 ATTGTAATTTTTAATTTTTATGG - Intronic
1203119085 16_KI270728v1_random:1520557-1520579 ATTGTAAACTTTATATTAAAAGG + Intergenic
1142846398 17:2680516-2680538 AAAGTAATGTTTTTATTATAAGG - Intronic
1142920977 17:3185677-3185699 AATATTATTTTTATATCTTATGG + Intergenic
1143881324 17:10032189-10032211 AATGTAATTATTAAATGACAAGG + Intronic
1144110987 17:12032437-12032459 AATATAATTTTTTTAATATTTGG - Intronic
1144404349 17:14938422-14938444 AATGTATTTTATAGATCATATGG - Intergenic
1145758689 17:27412062-27412084 AATGTAGGTTTTATACTAGAAGG - Intergenic
1146421640 17:32691799-32691821 AATATAATTTTTAGATTTTTTGG + Intronic
1146447656 17:32945229-32945251 AATGCAAATTTTATTTTAAATGG - Intergenic
1147724768 17:42559975-42559997 AATTTAATTTTTATTTTTTTTGG + Intergenic
1147730372 17:42596651-42596673 GATGTATTTTGTATATAATAAGG - Intronic
1147842810 17:43384296-43384318 AATGTAAGTTTTACATGACACGG + Intergenic
1148255148 17:46124532-46124554 AATGTATTTTTTAAATTATAAGG - Intronic
1148273030 17:46278719-46278741 GATATAATTTTTAAATTATAGGG - Intronic
1148291015 17:46449703-46449725 AATGTACTTTTTATATGAAATGG + Intergenic
1148313204 17:46667408-46667430 AATGTACTTTTTATATGAAATGG + Intronic
1149066051 17:52480293-52480315 ATTGTTATTATTATCTTATAAGG - Intergenic
1149070914 17:52541594-52541616 TATGGAATATTTATAATATATGG + Intergenic
1149090507 17:52772533-52772555 TATGTAAATTTTATGTTACAGGG - Intergenic
1149116253 17:53099953-53099975 AAACGAATTTTTATATTAAAGGG + Intergenic
1149278736 17:55076980-55077002 GATGTATTTTTTATGTTATCTGG + Intronic
1149669111 17:58389660-58389682 TATGTAAATTTAATATTATGGGG - Intronic
1149955744 17:61047582-61047604 TATGTAATTTTTATTTTAAAGGG - Intronic
1150202821 17:63374793-63374815 AATTTAAATTTTATATCAGAGGG + Intronic
1150671581 17:67204572-67204594 ATTGGAATTATTATCTTATAAGG - Intronic
1150763026 17:67979612-67979634 GATATAATTTTTAAATTATAGGG + Intronic
1151032939 17:70762588-70762610 AATTTTATTTTTATTTGATATGG + Intergenic
1152348040 17:79766436-79766458 TATTTTATTTTTATATTTTAGGG + Intergenic
1152952352 17:83245951-83245973 AATGTTATTTTTGGATTGTAAGG + Intergenic
1153000241 18:448494-448516 AATGTAATTTTTCTCTACTAAGG + Intronic
1153141581 18:1978621-1978643 AATGTTATTTTTAAAATAAAGGG - Intergenic
1153192639 18:2559243-2559265 AATGTAATATTTACATAAAATGG + Intronic
1153492735 18:5666335-5666357 AATGTATTTCTTAAATAATAAGG + Intergenic
1153683553 18:7523366-7523388 AGTGTAATATTCATATTAAATGG + Intergenic
1153912532 18:9716747-9716769 AATGGAATTTTTATTTGAGACGG + Intronic
1155492753 18:26416313-26416335 AATGGAATTTTTATAATATTAGG - Intergenic
1155559331 18:27058838-27058860 AATATCATTTTTATATCATTAGG + Intronic
1155600439 18:27539744-27539766 ATTTTTATTTTTATATTGTATGG + Intergenic
1155756976 18:29510662-29510684 AATATAATTTATTTTTTATATGG - Intergenic
1155758380 18:29531537-29531559 AATATTATTTGAATATTATAAGG + Intergenic
1155814293 18:30285597-30285619 AATCTAATTTATATTATATAAGG - Intergenic
1155884406 18:31189623-31189645 GAAGTATTTTTAATATTATAAGG - Intergenic
1156014308 18:32530831-32530853 ACTGTAATTTTTATATTTTCAGG + Intergenic
1156098829 18:33568838-33568860 AATGGAATTGTTGTATTTTATGG - Intergenic
1156102355 18:33612113-33612135 GATTTAGTTTTTATATTATTTGG + Intronic
1156320211 18:36013712-36013734 AATGTAATTTTTCTTTTTTCTGG + Intronic
1156791780 18:40984193-40984215 ATTTTATTTTTTATATTAGAAGG - Intergenic
1157019108 18:43757787-43757809 AATATAATATTAATATTACAAGG + Intergenic
1157077979 18:44488184-44488206 AATGACATTTTTAAATGATAAGG + Intergenic
1157267683 18:46242108-46242130 CTTGTAATTTGTATATTAGATGG + Intronic
1158262475 18:55623810-55623832 AATGTTATTTTAATATTTAATGG + Intronic
1158442396 18:57488652-57488674 AATGTTATTTTGTTATTAAAGGG + Exonic
1158846788 18:61452637-61452659 AAGATTATTTTCATATTATACGG - Intronic
1158851781 18:61502005-61502027 AATGCAATATATACATTATAGGG + Intronic
1158965562 18:62619380-62619402 AATGTAATTTGTATATTCTTGGG + Intergenic
1159228176 18:65568413-65568435 AAAGTAATTTTTAAATTTTTTGG + Intergenic
1159365212 18:67456598-67456620 AATATCAATTTTATATTATATGG + Intergenic
1159459487 18:68705725-68705747 GACATAATTTTTATATTATTTGG + Intronic
1159516691 18:69468415-69468437 AATTTTATTTTTAATTTATAGGG - Intronic
1159562770 18:70012913-70012935 AATTCAATTTTTTTATTTTAAGG + Intronic
1159662784 18:71119404-71119426 AGTGTAATATTAAGATTATATGG + Intergenic
1159888125 18:73928831-73928853 TATGTGAATTTTATGTTATAGGG - Intergenic
1160067037 18:75585018-75585040 AATGCAATTTTTAAATTATAAGG + Intergenic
1160237306 18:77096300-77096322 AATGTCATTTTAATAGTATCTGG + Intronic
1160316935 18:77857255-77857277 AATGAAATTCTTATATAATCGGG - Intergenic
1160653801 19:249531-249553 AATGTTATTTTTGGATTGTAAGG - Intergenic
1161867704 19:6846697-6846719 CATGTAATATTTATATTACATGG - Intronic
1162578987 19:11516354-11516376 AATTGAATTTTTAAATTAGAAGG + Intronic
1163061459 19:14765009-14765031 AATGTCATTTTTTTTTTAGACGG - Intronic
1163613914 19:18315310-18315332 CAGCTAATTTTTATATTTTATGG + Intronic
1163822998 19:19506900-19506922 AATTTAATTTTTTTTTTGTAGGG + Exonic
1164112519 19:22181970-22181992 AATTTAATTTTTGTCTTCTATGG + Intronic
1164550304 19:29205254-29205276 AAAATAATGTTTATATTTTATGG - Intergenic
1165295692 19:34924291-34924313 AAAGAAATTTTTAAATCATAGGG - Intergenic
1165303246 19:34986170-34986192 AATATAATTTTAATGTTGTAGGG + Intergenic
1165528665 19:36378522-36378544 AGTGTAATTTTTATTTTTTCTGG - Intronic
1167022222 19:46885948-46885970 AATGTGATTTTTAAATTTTAGGG + Intergenic
1167997319 19:53416762-53416784 TATGAAATTTCTATATTATTTGG + Intronic
1168047222 19:53802771-53802793 AATTTACTTTTTATTTTATTAGG + Intronic
1168488585 19:56787207-56787229 ATTGTACTTTTTGTATCATAGGG + Intronic
1168728340 19:58604174-58604196 AATGTTATTTTTGGATTGTAAGG + Intergenic
925105903 2:1290885-1290907 AGTTCAATTTTTAAATTATAAGG + Intronic
925517701 2:4703080-4703102 CATTTAATTTTTCTATTATTTGG + Intergenic
925830731 2:7892650-7892672 ACTTCACTTTTTATATTATATGG + Intergenic
926332370 2:11836176-11836198 CATGATATTTTTATACTATAAGG - Intergenic
926492106 2:13537462-13537484 AATGAATTTTTTAGATTAGAAGG - Intergenic
926545954 2:14240305-14240327 AACCTATTTTTTATATTTTAAGG + Intergenic
926663249 2:15491816-15491838 AATGTAAATTTTATGTGACATGG - Intronic
926996193 2:18738828-18738850 AATGTAATTTTTAAATTGTAGGG - Intergenic
927222379 2:20725292-20725314 ATTGTATTTTTTATTTTAAAGGG - Intronic
927282200 2:21318672-21318694 AAAGTACTTTGAATATTATAAGG + Intergenic
927308969 2:21606794-21606816 AAAGTACTTTGAATATTATAAGG + Intergenic
927351440 2:22122060-22122082 AATATAGATATTATATTATAGGG + Intergenic
927968586 2:27288655-27288677 AATGTATTCTATAAATTATAAGG - Intronic
928606543 2:32948554-32948576 AATTTATTTTTTCTATTATCTGG - Intronic
928670791 2:33601300-33601322 TATGAAATTTTTATATATTATGG + Intergenic
928683112 2:33723001-33723023 AATGTTATCTGTATATTAAAGGG - Intergenic
928809751 2:35208660-35208682 AGTGTAATTTTTGGATCATAAGG + Intergenic
929678232 2:43960359-43960381 GAAGTAATTTTAATGTTATAAGG - Intronic
930613574 2:53570315-53570337 TATGTTATTTGTTTATTATACGG + Intronic
930657745 2:54022998-54023020 AATGTAAGTCTTATATGATATGG - Intronic
930920056 2:56742181-56742203 AATATAAATTTTATGTAATACGG - Intergenic
931614258 2:64139611-64139633 AATGTATTTTATTTATTTTATGG + Intronic
931639124 2:64366079-64366101 ATTGCCATTTTTATATTATTCGG - Intergenic
931922581 2:67037228-67037250 AATGAAATTTTTAACTTATTTGG + Intergenic
931935420 2:67191374-67191396 AATGTAATTTATAGATTCAATGG - Intergenic
932064738 2:68542780-68542802 AGTGGAATTTCTATATAATAGGG - Intronic
932107340 2:68956852-68956874 AATGTATATTTTATATCATCAGG + Intergenic
932553667 2:72798616-72798638 AATGGAATTTTTATGGTTTATGG - Intronic
932679454 2:73811384-73811406 TTTCTAATTTTTAAATTATATGG + Intronic
932861644 2:75298993-75299015 AAGGTAATTTTTTTATTAATAGG + Intergenic
933081784 2:77998153-77998175 AAATGAATTTTTAAATTATATGG + Intergenic
933113008 2:78428270-78428292 AATGGGATTGTTAAATTATATGG - Intergenic
933274508 2:80269109-80269131 ACTTGAATTTTTATATTAAAAGG + Intronic
933407545 2:81880543-81880565 AATTTTATTTTTTTATTTTAAGG - Intergenic
933542055 2:83658426-83658448 AATGCCATTATTATATAATACGG + Intergenic
933626066 2:84601049-84601071 AATGTTATTATTATACTATAAGG + Intronic
933814750 2:86057008-86057030 AATGTATTTCTTAAATAATAAGG - Intronic
934302885 2:91792385-91792407 GATGTTATTTTTATTTTATTTGG - Intergenic
934487846 2:94734071-94734093 AAAATTATTTTTAGATTATAAGG - Intergenic
934798110 2:97120462-97120484 AACCTAATTTTTTTATTTTAGGG - Intronic
935456811 2:103279060-103279082 AAGTTAATTTTAACATTATATGG + Intergenic
935462665 2:103356418-103356440 AATGTAAGTTTTATGTGACACGG + Intergenic
935803619 2:106725439-106725461 TATGTAATATATATAATATATGG + Intergenic
936147347 2:109988992-109989014 AGTGCAATTGCTATATTATATGG + Intergenic
936197345 2:110382492-110382514 AGTGCAATTGCTATATTATATGG - Intergenic
936247632 2:110842474-110842496 AATATAAGTTTTATATAACATGG + Intronic
936549423 2:113423039-113423061 AAGGTATGTTTTATATAATAAGG - Intergenic
936570215 2:113606836-113606858 AATGTTATTTTTGGATTGTAAGG - Intergenic
936671170 2:114658775-114658797 AATGTAATTATTATATCTTCTGG + Intronic
936833227 2:116675041-116675063 AATGTGATTTTTAAAATACATGG - Intergenic
936834503 2:116691588-116691610 AATATAATTATTATTTTAAAAGG - Intergenic
937192173 2:120113013-120113035 AATGTAATAATTCTATTTTAGGG + Intronic
937193518 2:120128802-120128824 AAAGTAATTTTGATTTTTTAAGG + Intronic
937585756 2:123547415-123547437 AATGTAACTATTATATACTAAGG + Intergenic
937629167 2:124080057-124080079 CATGTAATTTTTGTTTAATATGG + Intronic
938237249 2:129716461-129716483 AATATAATTTTTTTATTAATTGG + Intergenic
938856559 2:135318143-135318165 AATATAATTTTTATATTATTAGG - Intronic
939237594 2:139517406-139517428 AATGTAATATATAAATTATTTGG - Intergenic
939241388 2:139564823-139564845 AATGTAATTCTCATAAAATAAGG - Intergenic
939271161 2:139941459-139941481 AATGTAAATATTTTATAATAGGG + Intergenic
939272873 2:139962324-139962346 AATTTTATATTTATATTTTAAGG - Intergenic
940500016 2:154482100-154482122 ACTGAAATTTTTAGAATATATGG + Intergenic
941056004 2:160789333-160789355 AGTGTAGTTTTTAAATGATAAGG + Intergenic
941706453 2:168663547-168663569 AATGTGAATTTAAAATTATAGGG - Intronic
941981938 2:171467967-171467989 AATTTAATTTTTAGTTTATGAGG - Intronic
942193333 2:173493052-173493074 AAGGTAATTTTTACATGAAATGG + Intergenic
942357239 2:175130119-175130141 AAAGTAATTTATATATTACCTGG + Exonic
942725917 2:179007596-179007618 AATGAGATTTTTATTTTAAATGG + Intronic
942810061 2:179988355-179988377 TATGTAATTTTTATGTGAAAGGG - Intronic
942852231 2:180501697-180501719 AGTTTAATTTTTATATTAAAGGG - Intergenic
943193597 2:184714106-184714128 AGAATAATTTGTATATTATAGGG + Intronic
943362706 2:186941527-186941549 CATGTAATTTTAATAATATATGG - Intergenic
943650086 2:190448277-190448299 AATGTAATTTTTAGGCCATAGGG - Intronic
944246803 2:197538875-197538897 AATGTTATTTTTGTAATCTAAGG + Intronic
944999522 2:205333390-205333412 AAATTAATTTTAATATTTTAAGG - Intronic
945411250 2:209511141-209511163 AATGTATTTTTTAAATTTTGAGG - Intronic
945479783 2:210331637-210331659 TTTCTAATTTGTATATTATAGGG + Intergenic
945579739 2:211578447-211578469 AAACTATTTTTTAAATTATATGG + Intronic
945608275 2:211964331-211964353 AATGTGATATTTATATGAAATGG - Intronic
945650107 2:212547176-212547198 AAAGTAATTTTTCCATTTTATGG - Intergenic
945717180 2:213372551-213372573 CATGTAATTATTAGACTATATGG + Intronic
946267182 2:218556201-218556223 AAAGTTATTTTTAAAATATATGG - Intronic
946287227 2:218712991-218713013 AATGGAATTTTTAAGTTATTTGG + Intronic
946564708 2:220951079-220951101 TCAGTAATTTTTAAATTATAAGG + Intergenic
946589600 2:221230144-221230166 AATATATTTTTTAAATTACATGG + Intergenic
946680097 2:222204619-222204641 AATGTGATTTTTTTAATAAAAGG + Intronic
946977795 2:225173066-225173088 AATGCAATTTTTATATTAATGGG + Intergenic
946983209 2:225241577-225241599 AATGGTATTTTTACATTATCAGG - Intergenic
947035344 2:225847276-225847298 AATATAATTTTTATATTCACTGG - Intergenic
947143554 2:227042286-227042308 AATGTAATTCATTTATTATCTGG - Intronic
947160444 2:227208934-227208956 CATGGAATTTTTATCTTAAATGG + Intronic
948215885 2:236230857-236230879 AATGTAATTTTGATATGGTTAGG - Intronic
948498184 2:238368579-238368601 TATGTAAGTTTTATATTTTCAGG + Intronic
948643968 2:239392429-239392451 GATGTAAATTTTATAGTAGAGGG + Intronic
948842191 2:240657393-240657415 ACTGTAATTATTATATGATTAGG - Intergenic
949088598 2:242179815-242179837 AATGTTATTTTTGGATTGTAAGG + Intergenic
1168741671 20:197283-197305 GAGTTAATTTTTGTATTATATGG - Intergenic
1169203030 20:3723785-3723807 AGTGTAATTGTTAGATTGTATGG - Intergenic
1169606338 20:7323744-7323766 AATTTAATTATTATTTGATAAGG - Intergenic
1169608944 20:7357300-7357322 AAGATAATTTTCATATTATCAGG - Intergenic
1169822341 20:9726014-9726036 AAAATAATTTTTATATTTAAAGG + Intronic
1170002683 20:11632657-11632679 AATGTAAGTTTGACATTATCTGG - Intergenic
1170230115 20:14037101-14037123 AATGTAACTTTTATTTTAAAGGG + Intronic
1170253912 20:14318417-14318439 TATCTCATTTTTATGTTATATGG - Intronic
1170287668 20:14728310-14728332 AAAGGAATGTTTAAATTATAAGG - Intronic
1170941347 20:20850611-20850633 AATGTATTTTTTAATTTTTAGGG + Intergenic
1171814839 20:29776567-29776589 AATGTAAATTTTATGAAATATGG - Intergenic
1172075240 20:32291235-32291257 AGGGTAAATTTTATATTATGTGG + Intronic
1172336502 20:34120922-34120944 AATTGAATTGTTAGATTATATGG - Intergenic
1172684309 20:36742150-36742172 TATATAATTGTTAAATTATATGG - Intronic
1173058954 20:39643700-39643722 ATTTTAATTTTTATTTTTTATGG + Intergenic
1173084526 20:39903093-39903115 GTTGTAATTATTTTATTATAAGG + Intergenic
1173128912 20:40368485-40368507 AATCGTATTTTTAAATTATAAGG - Intergenic
1173417476 20:42869719-42869741 AATGTATTTTGTATATGAGAAGG + Intronic
1174029962 20:47615794-47615816 AACGCTATTTCTATATTATATGG - Intronic
1174034262 20:47657981-47658003 ATTGGAATTTTTAAATCATAGGG - Exonic
1174246024 20:49181194-49181216 ACTGCAACTTTTATATTATTAGG + Intronic
1174894072 20:54429950-54429972 CATGTATTTTGTATGTTATATGG + Intergenic
1174909617 20:54593106-54593128 AATGTAAATTTTAAATAATTGGG - Intronic
1174909640 20:54593295-54593317 AATGTAAATTTTAAATAATTGGG - Intronic
1176727200 21:10447984-10448006 AATGCCATTAATATATTATATGG - Intergenic
1176913198 21:14593494-14593516 GATGTGATTTTAATATCATAAGG + Intronic
1177144103 21:17388879-17388901 AATCTAAGGTTTAAATTATAAGG + Intergenic
1177418851 21:20828862-20828884 AATGTACTTTCCATATAATATGG - Intergenic
1177437591 21:21076171-21076193 AAAGTATAATTTATATTATAAGG + Intronic
1177466224 21:21484560-21484582 AATGTCATTGTTATATCATATGG + Intronic
1177558247 21:22718373-22718395 AATGTAAATTCAATATGATATGG + Intergenic
1177621382 21:23599452-23599474 AATGTGATTTTTTTATTCTACGG + Intergenic
1177689515 21:24486734-24486756 AATGATAATTCTATATTATAAGG + Intergenic
1177693445 21:24540261-24540283 AATGTATTTTTTATTTGAAAAGG - Intergenic
1178298948 21:31435438-31435460 AATCTAATTTTCATATAAAAAGG + Intronic
1178456335 21:32756041-32756063 AAAGAAATTTTTATAAAATATGG - Intronic
1180263765 21:46695776-46695798 AATGTTATTTTTGGATTGTAAGG + Intergenic
1180287195 22:10759067-10759089 AATGCCATTAATATATTATATGG + Intergenic
1180707914 22:17820796-17820818 AATATAATTTTTATGATAAATGG - Intronic
1181374895 22:22449664-22449686 AATTCAATTTTTGTATTACATGG - Intergenic
1181515890 22:23412581-23412603 AATGTATTTTTTAAATAACAAGG - Intergenic
1181912484 22:26250696-26250718 AATGTCATTGGTATTTTATAGGG + Intronic
1183801225 22:40166351-40166373 AATGTAATATTTGTATTAATTGG + Intronic
1183944295 22:41315950-41315972 AATGTATTTTGTATGTGATAAGG - Intronic
1185091342 22:48776627-48776649 TATGTAATTTCTATATTACTAGG + Intronic
1185308225 22:50135316-50135338 AGTTTTATTTTTAAATTATATGG + Intronic
1185429995 22:50804136-50804158 AATGTTATTTTTGGATTGTAAGG + Intergenic
949161556 3:889764-889786 ATTGTATTTGTTATATTTTAAGG - Intergenic
949211586 3:1509520-1509542 AATATGTTTTTTATATAATATGG - Intergenic
949278610 3:2319234-2319256 ACTGTAATATTTATCTTATGTGG - Intronic
949385667 3:3499569-3499591 AAAGCAATTTTTAAATTATGTGG - Intergenic
949845698 3:8368434-8368456 AATGTGATTTTTACATGAGAGGG + Intergenic
950598675 3:14010666-14010688 ACTGTGATTTTTATATTAGGTGG - Intronic
950806672 3:15610044-15610066 AATCTAATTGACATATTATATGG - Intronic
950817219 3:15718013-15718035 AATCAAATTTTTATAATAAAGGG + Intronic
950925494 3:16736868-16736890 AATGGAATTTCTGGATTATACGG + Intergenic
950976229 3:17248516-17248538 AATGTATTTCTTAAATAATAAGG + Intronic
951067765 3:18287593-18287615 AATGCAATTTTTACATTGCAGGG + Intronic
951112937 3:18826534-18826556 AATATATTATATATATTATATGG - Intergenic
951114360 3:18842881-18842903 AATGTAATTTCTGTATAATCTGG + Intergenic
951137605 3:19121839-19121861 AAAGGAATTTTTATATTTTATGG - Intergenic
951158023 3:19378590-19378612 AATGTGATTTTAGTATTTTAAGG + Intronic
951310519 3:21120119-21120141 AATGTCATTTGTCTGTTATAGGG + Intergenic
951373081 3:21876772-21876794 AATGTTATTTTCACATTAGATGG - Intronic
951427103 3:22560058-22560080 AATGGAATTGCTAGATTATATGG - Intergenic
951667187 3:25140170-25140192 AATGTATTTATTAAATAATAAGG - Intergenic
951684357 3:25327799-25327821 AATGTAATTGGTATATTATCTGG + Intronic
951824828 3:26857265-26857287 TATATAACTTTTAAATTATACGG + Intergenic
951940291 3:28070238-28070260 ATTGTAATTTTTAGATTTTGTGG - Intergenic
951963339 3:28353311-28353333 AATTTACTTTTTTTATTGTAGGG + Intronic
952051660 3:29391805-29391827 AATCATATTTTTATATAATATGG - Intronic
952175894 3:30862386-30862408 ATTGTATTATTTATATTTTAAGG - Intronic
952573808 3:34749408-34749430 AATTTTATTTCTATTTTATAAGG + Intergenic
952576978 3:34787063-34787085 AATGTAATCTTTATCACATAAGG + Intergenic
952593303 3:34984246-34984268 AATGTAAATTTAATATAATCAGG + Intergenic
952773794 3:37025396-37025418 AAGATAATTTTAAGATTATAAGG + Intronic
953445688 3:42963493-42963515 AATGGAATTGTTTTATTATAGGG - Intronic
953827784 3:46268997-46269019 AATCCAACTTTTTTATTATATGG - Intergenic
953849172 3:46452766-46452788 AATATACTTTTTTTATTGTAAGG + Intronic
953891929 3:46757088-46757110 AGTGTAATTTTTTTTTTCTATGG + Intronic
955678156 3:61471249-61471271 AATGTATTTCTTAAATAATAAGG + Intergenic
955702750 3:61698107-61698129 AATGTAAGTTTTATGTGACACGG - Intronic
956096547 3:65722320-65722342 AAAGTAATTTTTTTATTGTCCGG - Intronic
956131509 3:66057887-66057909 AATTTCATTTTTATATTTAAGGG - Intergenic
956266325 3:67400263-67400285 AAAATAATTTGTATATTTTATGG - Intronic
956613710 3:71150389-71150411 AATGTAATAGATATATTCTAGGG - Intronic
956964311 3:74441090-74441112 AATGTAATTTATAACTTATGGGG + Intronic
956998162 3:74851756-74851778 AATATAATTTCTAGATGATATGG + Intergenic
957148039 3:76448985-76449007 AAAGCAATTTTTAAATTGTAAGG + Intronic
957237766 3:77616888-77616910 AGTATTATTTTTATTTTATAGGG + Intronic
957334975 3:78816473-78816495 AATGTATTTCTTAAATAATAAGG - Intronic
957501269 3:81060165-81060187 ATTGTAATTTTTATATATAAAGG - Intergenic
957517681 3:81277178-81277200 TATGTAATTTTGATGTTATTAGG + Intergenic
958134390 3:89469043-89469065 AAATTAATATTTATATAATATGG + Intronic
958190358 3:90176502-90176524 ATAGTAATTTTTATAGTTTATGG + Intergenic
958864311 3:99483239-99483261 AATGTAAGTTTTATGTGACATGG - Intergenic
959187389 3:103062516-103062538 AATGTAATATTGATATATTAGGG - Intergenic
959207850 3:103335128-103335150 ATTATCAGTTTTATATTATAGGG + Intergenic
959273686 3:104247990-104248012 TATGAAATTTTTGTACTATAGGG + Intergenic
959339964 3:105116965-105116987 AATGTTATTTTTATAATTTTTGG - Intergenic
959367139 3:105475842-105475864 AATCTATTTTTTATCTTAAATGG - Intronic
959476492 3:106818553-106818575 GATCTATTTTCTATATTATAAGG + Intergenic
959488240 3:106953912-106953934 AATATAATTCTTACATTTTAGGG + Intergenic
959550113 3:107645291-107645313 AAAATAATTTTTATTTTTTAAGG - Intronic
960219678 3:115091043-115091065 ATTGTACTTTATTTATTATATGG + Intronic
960343903 3:116508750-116508772 AATTTATTTATTATCTTATATGG - Intronic
960411248 3:117328112-117328134 ATTGTTATTTTTATATTAAATGG - Intergenic
960411680 3:117334669-117334691 CATGTATTTTTTGTCTTATAAGG + Intergenic
960613628 3:119577723-119577745 AAAGTAATCAATATATTATATGG - Intergenic
960725866 3:120669227-120669249 AATGTATTTTCTATATTTTGTGG + Intronic
960912089 3:122659400-122659422 AATATAATTTTTATTGTATGTGG + Intergenic
960929517 3:122831247-122831269 AATGTAATTTCTGGATTGTATGG - Intronic
961482180 3:127189918-127189940 AGTGTAAATTTTGGATTATAGGG + Intergenic
961958731 3:130831752-130831774 ACAGTAAATTTTATGTTATATGG + Intergenic
962142119 3:132801656-132801678 TATGTAAGTTTTATATTTGAAGG - Intergenic
962441250 3:135418962-135418984 AATATATTTTTAATATTTTATGG + Intergenic
962771893 3:138619223-138619245 AATGTAATCTTTATTTTAGAAGG - Intronic
963035985 3:141029747-141029769 AATATATTTTGTATACTATAGGG + Intergenic
963341833 3:144045516-144045538 AATGTAATTTTTAGAATATCTGG + Intronic
963361182 3:144273975-144273997 AATGTAATCTGTATTTTGTAAGG + Intergenic
963428907 3:145170993-145171015 AATGTGAGTTATATATCATATGG + Intergenic
963452351 3:145498857-145498879 AATGTTTTTTATATATAATACGG + Intergenic
963758822 3:149264461-149264483 AATGTTATTGGTATTTTATAGGG - Intergenic
964262947 3:154860749-154860771 ATTGTAGTTTTTATATCATTTGG - Intergenic
964336337 3:155658665-155658687 AAAGTAAATTTTATTTTTTAAGG - Intronic
964402641 3:156315007-156315029 AATATAATTTTTTTTTTAGATGG - Intronic
964473168 3:157075477-157075499 AATGTTGTTTTTATATTAAGTGG - Intergenic
964533416 3:157693229-157693251 AATGTAAATTTTTTATTGTTAGG + Intergenic
964535091 3:157712379-157712401 AATGTATTTCTTAAATAATAAGG - Intergenic
964895706 3:161592111-161592133 AATGTATTTTTCATAGTCTAGGG - Intergenic
964997306 3:162898863-162898885 AATAAATTTTTTATTTTATATGG + Intergenic
964997880 3:162909519-162909541 AATGTAATTTCTAAATTAATAGG - Intergenic
965255395 3:166400657-166400679 GATGTAATTTTGAAATTTTAAGG - Intergenic
965264585 3:166525120-166525142 AAAGTAATTTTTATATATTAAGG + Intergenic
965403606 3:168244103-168244125 AATGTAATTTTTATATGTACTGG + Intergenic
965424937 3:168510898-168510920 AATGTAATATTTATCTTGCAAGG + Intergenic
965441329 3:168718818-168718840 CATGTAGTTTTTATATTACAAGG + Intergenic
965740794 3:171872350-171872372 ATTTAAATTTTTATTTTATAAGG - Intronic
965829020 3:172761588-172761610 ACTGTAATGTTTATATTTTTAGG + Exonic
965867591 3:173224431-173224453 AAAATAATTTTTATAAGATAAGG - Intergenic
965906458 3:173713301-173713323 AATGAAATATTTGTATTATTTGG + Intronic
965918009 3:173874489-173874511 AATATAATTTTAATAATATTTGG + Intronic
966018433 3:175173996-175174018 TATGTAATTGTAATTTTATATGG + Intronic
966074678 3:175922370-175922392 AGGGCAATTTTTATAATATAAGG + Intergenic
966339337 3:178907862-178907884 AAAATAATTTTTAAACTATAAGG + Intergenic
966439204 3:179924798-179924820 ACATTAATTTTTATATTTTAGGG + Intronic
966520740 3:180870742-180870764 GATGTAATTCATATATCATACGG - Intronic
967350986 3:188513632-188513654 TATATTATTTTTATTTTATAAGG + Intronic
967440809 3:189506503-189506525 AATGAACTTTTTATTTGATAAGG - Intergenic
967509645 3:190294465-190294487 AATTTAATTTTTAAATTTTCTGG + Intergenic
967676342 3:192303160-192303182 AATGTACTTTTTCTTTTGTAAGG + Intronic
968209154 3:196833526-196833548 AATGTATTTGTTACACTATATGG + Intergenic
968352360 3:198069442-198069464 TATTTAATTTTTATAATAAATGG - Intergenic
969165121 4:5302181-5302203 TTTGTAATTTTGAAATTATATGG - Intronic
970103184 4:12548621-12548643 AATGTAAATTTTATTTTTAATGG + Intergenic
970173239 4:13309881-13309903 AATGGAATTTTTAGCATATATGG - Intergenic
970366978 4:15369541-15369563 AAAATAATTTATATATGATAAGG - Intronic
970383299 4:15530398-15530420 AAATTATTTTTTATATTAAAAGG + Intronic
970525136 4:16924454-16924476 AATGTAAGTTTTACATGACATGG - Intergenic
970922277 4:21409014-21409036 AACTTAATTTTTATGTTATTTGG + Intronic
971132597 4:23829435-23829457 AATGTAAATTTTTTAATACAGGG - Intronic
971275901 4:25196410-25196432 TATGTAATTTATAAATTATATGG - Intronic
971458216 4:26864506-26864528 AATGTAATGTTTCAATTATTCGG - Intronic
971890075 4:32508402-32508424 AATGTGATTTTTATATGAAAGGG + Intergenic
972982636 4:44724565-44724587 ATTCTTATTTTTATATTAAATGG + Intronic
973020240 4:45195887-45195909 AATGTAATACTTATATGATAAGG - Intergenic
973320513 4:48805799-48805821 AATTTTATTTTTGTATTTTAGGG + Intronic
973591951 4:52451286-52451308 ATTATAATTTTTCAATTATAAGG - Intergenic
974629695 4:64470165-64470187 AAAGTAATTTTTAATTTTTAAGG - Intergenic
974845364 4:67345369-67345391 AATATAAGTTTTATATGACATGG + Intergenic
975058875 4:69971970-69971992 AATGAAATTTTATGATTATATGG - Intergenic
975105368 4:70562400-70562422 AATGTATTGTTTAAATTATATGG + Intergenic
975176100 4:71290735-71290757 CAGGTGATTTTTATATTATGTGG + Intronic
975221697 4:71820077-71820099 TATGTAATTGTTATACTGTATGG - Intergenic
975422076 4:74177719-74177741 AATGGAATTTTTTGATCATACGG - Intronic
975901277 4:79156089-79156111 ACTGTAGTTTTTAAACTATATGG - Intergenic
975976328 4:80100945-80100967 AATAGAATTTTTATATAATCAGG + Intronic
976006610 4:80437799-80437821 ATTGTAATTTTTATTTTAATGGG + Intronic
976110378 4:81667034-81667056 AATGTTATATTTATAATAAATGG - Intronic
976310345 4:83605544-83605566 AATGTGATTTTTTTTTTTTAAGG - Exonic
976329796 4:83816990-83817012 AATATAATATTTAAATTATCTGG - Intergenic
976378968 4:84377983-84378005 AATGTAACTTTTATACTTGAGGG + Intergenic
976445240 4:85123456-85123478 AATTTAATTTTTAATTTTTATGG + Intergenic
976766192 4:88600576-88600598 ACTGTGATTTTTATTTTTTATGG + Intronic
976795433 4:88926875-88926897 AATTTAACTTTTATATAATTAGG + Intronic
976837859 4:89396175-89396197 ATTGTAATTTTTATTTTGTTTGG + Intergenic
976866233 4:89730747-89730769 TATTTAATTTATATATTATTTGG - Intronic
976913484 4:90339399-90339421 AATTTAATTTAGATATTAAAAGG - Intronic
976964276 4:91016548-91016570 AAATTAATTTTTTTGTTATATGG - Intronic
976989726 4:91350779-91350801 ACTGTCATTTTTATATTTTATGG + Intronic
977005100 4:91558095-91558117 AATATATTTTTTTTATTAAAAGG - Intronic
977017814 4:91715507-91715529 TATGTAATTTTTTTTTTATGAGG + Intergenic
977090520 4:92669327-92669349 GATGTATTTGTTATATTTTAGGG - Intronic
977196069 4:94061920-94061942 AATAGAATTTTTTTATTTTAGGG + Intergenic
977316200 4:95451030-95451052 AATGTAGTTTTTACATTGTATGG - Intronic
977739626 4:100462582-100462604 AGTTTTATTTTTATATTATAGGG + Intronic
977741836 4:100493680-100493702 AATGCAATTATTATTTTACACGG + Intronic
978061073 4:104339841-104339863 CATATAAATTGTATATTATATGG + Intergenic
978103123 4:104867692-104867714 AATGTAAATATTATATTAAGAGG + Intergenic
978307168 4:107342682-107342704 ACTGTCATTTATATTTTATAGGG - Intergenic
978428669 4:108609241-108609263 ATTTTTATTTTTATTTTATATGG + Intergenic
978684925 4:111429199-111429221 AATGTGATTTTGTTTTTATAAGG + Intergenic
978841090 4:113213535-113213557 AATCAAAGATTTATATTATAGGG - Intronic
978882630 4:113725419-113725441 AAAGTATATTTTATATTATTAGG - Intronic
978960597 4:114673094-114673116 AAGGTAATTGTTTTATTAAAAGG + Intronic
979087529 4:116432082-116432104 AATGTAAGTTTTACATTACATGG + Intergenic
979144807 4:117231198-117231220 AAAGAAATTTTCAAATTATATGG + Intergenic
979280084 4:118857808-118857830 AAAGTATTTTATTTATTATAAGG + Intronic
979413128 4:120403960-120403982 AATGCACTTTTAAGATTATATGG + Intergenic
979416813 4:120451572-120451594 ATTATAATTTTTACATTAAAAGG + Intergenic
979486918 4:121280718-121280740 AAGACAATTTTTATATTATTAGG + Intergenic
979571033 4:122225020-122225042 AATCTTATTTTTCTACTATATGG + Intronic
979656454 4:123199876-123199898 CATGTAGTTTTTATTTTATGTGG + Intronic
979695230 4:123605507-123605529 AATGTAACTTTTATATTCACTGG + Intergenic
979741043 4:124151486-124151508 AGTGTAATATTTATATTAGTAGG - Intergenic
979814707 4:125086450-125086472 AATGTTATTTAAAAATTATAAGG - Intergenic
979999173 4:127468452-127468474 AATTTAAGTTTTATATATTAGGG - Intergenic
980004093 4:127521138-127521160 ATTGTAATCTTTAGATAATAAGG + Intergenic
980401039 4:132286286-132286308 AATTAAATGTTTATATTCTAGGG - Intergenic
980548510 4:134302492-134302514 CATGTAAATTTTATAATATCTGG - Intergenic
980989524 4:139727391-139727413 AGTTAAATTCTTATATTATATGG - Intronic
981104947 4:140870022-140870044 AATGTAATTTTTTCATGATGTGG + Intronic
981137865 4:141233533-141233555 ACTGTAATTTTTATTTTTTATGG + Intronic
981548430 4:145917909-145917931 AATGAAATTCTTATAATATGTGG - Intronic
981820663 4:148883272-148883294 AATGACATTATTAAATTATACGG - Intergenic
981926906 4:150150480-150150502 AAAATAATTTTTATAAAATAAGG + Intronic
982059313 4:151587444-151587466 AAGGTAATATTTATGCTATATGG - Intronic
982350322 4:154408227-154408249 AATGTAATTTTAAAATGATCTGG - Intronic
982351294 4:154418074-154418096 TTTGTAACATTTATATTATATGG + Intronic
982403473 4:154994866-154994888 AAAGTTGTTTTTTTATTATATGG + Intergenic
982445221 4:155483171-155483193 AATGTATATTTTATGTTGTAGGG + Intergenic
982546481 4:156739223-156739245 AATATATTTTTTATATTTCATGG - Intergenic
982593323 4:157345105-157345127 AAAGTAATATTAATATAATATGG - Intronic
982813142 4:159851863-159851885 AATGTAATTTTTATATGAAGAGG + Intergenic
982880072 4:160702762-160702784 AAAGTAAATTTTATTTTAGAAGG - Intergenic
983033024 4:162827408-162827430 AATATATTTTTTAAATTATCTGG + Intergenic
983680589 4:170348979-170349001 AAAATACTTTTTATATTTTAGGG + Intergenic
983701417 4:170599639-170599661 AATGTAGCTATTGTATTATAGGG - Intergenic
983719479 4:170831039-170831061 AAGTTTATTTTTAAATTATAGGG + Intergenic
984105410 4:175539416-175539438 AATGTAATTTTTCTACTTTAAGG - Intergenic
984121302 4:175748342-175748364 AATGTATTTCTTAAATAATAAGG + Intronic
984158018 4:176215767-176215789 AATGAATTTTTTATGTTGTAAGG + Intronic
984177167 4:176433619-176433641 AATGTAATTTTTTTTTAAAAAGG - Intergenic
984181700 4:176490933-176490955 AATATAATGAATATATTATAGGG + Intergenic
984225566 4:177030816-177030838 TATGTAATTTTTATATTTCCAGG + Intergenic
984361183 4:178734729-178734751 AATGTGATATTTGTTTTATAGGG + Intergenic
984605710 4:181783603-181783625 CATTTAATTTTTATATTAATTGG + Intergenic
985103573 4:186481222-186481244 AATGTTATTTTTCTTTTCTATGG + Intronic
985220910 4:187704087-187704109 TATGTAATGTTTATATTTTCAGG - Intergenic
985307303 4:188557517-188557539 AATGTATATTTTATAGTTTATGG - Intergenic
985331968 4:188847423-188847445 AATGTAATCTTCATAATAAATGG - Intergenic
985353273 4:189089772-189089794 AATGACATTTTTGTAGTATAAGG - Intergenic
985394924 4:189531884-189531906 ACTGTAATATTTACATTTTATGG + Intergenic
985466427 4:190201022-190201044 AATGTTATTTTTGGATTGTAAGG + Intergenic
985891913 5:2722632-2722654 AAAATAATTTTTTTAATATATGG + Intergenic
985951367 5:3223813-3223835 AATGCAATTTACATATTTTAAGG + Intergenic
986646998 5:9926949-9926971 AATTTAATTTTTAAAGAATATGG + Intergenic
986911113 5:12558475-12558497 AATGTAAATTTTAAGTTTTAAGG + Intergenic
986916849 5:12630298-12630320 AATATTATTATTATATTATCTGG - Intergenic
987168524 5:15226580-15226602 AGTGGAATTGTTATATCATATGG + Intergenic
987202501 5:15591491-15591513 AATATTATTTTCATTTTATAAGG - Intronic
987454608 5:18128137-18128159 AATGTATTTCTTAAATAATAAGG + Intergenic
987509649 5:18819912-18819934 AATTTAATTTTTATAAATTAAGG + Intergenic
987666991 5:20955755-20955777 TATGTAATTATTATTTTATTGGG + Intergenic
987963713 5:24845269-24845291 AATGTTATTTATATAATATTTGG - Intergenic
987974028 5:24988918-24988940 AATGGAATTTCTGGATTATATGG + Intergenic
988032860 5:25787449-25787471 AATGAAATTTTTGGATCATATGG + Intergenic
988117418 5:26914166-26914188 AGTGAAAGTTTTATATTGTAAGG + Intronic
988170879 5:27653505-27653527 AATGGGATTTCTTTATTATATGG + Intergenic
988179607 5:27772857-27772879 AATGTTTTTTTTTTTTTATATGG + Intergenic
988264824 5:28934939-28934961 AAAGTACTTTTTATATTTTATGG + Intergenic
988288137 5:29248450-29248472 AATATAATTTTTATATTTATGGG - Intergenic
988362071 5:30249216-30249238 ATTTTAATTTTTATATAATTAGG + Intergenic
988420354 5:30998441-30998463 CATGTAATTTTTATATGACATGG - Intergenic
988431595 5:31125386-31125408 AATGTTATTATTATATGTTATGG + Intergenic
988435450 5:31169367-31169389 AATATAAGTTCTATATTAAATGG + Intergenic
988784040 5:34549555-34549577 AAGGAGATTTTTATATTAAAAGG - Intergenic
988847567 5:35144365-35144387 AATGTAATTTATGTGTTGTATGG + Intronic
988866146 5:35337419-35337441 TTTATAATTTTTATATTTTAAGG + Intergenic
988919576 5:35927902-35927924 AATGCAATATTTATTTTAGAAGG - Intronic
989005521 5:36807089-36807111 AATTTAAAATTTATTTTATAAGG - Intergenic
989304027 5:39930761-39930783 AAAGTAATTTTTATTTTCAATGG + Intergenic
990123833 5:52489566-52489588 AAATTAAATTTTAAATTATATGG + Intergenic
990196765 5:53325950-53325972 AATGTCATAATTATATTACAAGG + Intergenic
990363134 5:55042067-55042089 AATATTATTTTTCTATTTTAGGG - Intergenic
990427719 5:55704559-55704581 AATAAAATTTTTATATTGTAGGG + Intronic
990832748 5:59978168-59978190 AATGTATTTCTTAAATAATAAGG - Intronic
991044398 5:62208140-62208162 AATTTGATTTTTATTTTAAAGGG - Intergenic
991188682 5:63842467-63842489 AATGTATTTCTTACATAATAAGG - Intergenic
991227981 5:64295053-64295075 AATGTAAGTGTTATGTTTTAGGG + Intronic
991658368 5:68926101-68926123 AATGTAAGTTTTATGTGACATGG + Intergenic
991676159 5:69091783-69091805 ATAGTAATATTTATATTGTAGGG - Intergenic
992028381 5:72694488-72694510 AATATAATTTTTCTATAATTCGG + Intergenic
992193769 5:74319569-74319591 AATGGAATTGTTACATCATATGG - Intergenic
992605513 5:78452138-78452160 AGTGTAATTATTGGATTATATGG + Intronic
993118389 5:83744921-83744943 AAGGTAATTTCTCTATTTTAAGG - Intergenic
993136643 5:83975290-83975312 ACTGTGATTTTTAAAATATAAGG - Intronic
993254256 5:85567678-85567700 AATGTAATTTTGATATATTCAGG - Intergenic
993452052 5:88084193-88084215 AATTTAATTTTTTAACTATAAGG - Intergenic
993688266 5:90967408-90967430 TATGTAAGTTTTATGTTATATGG - Intronic
993755988 5:91730529-91730551 AATTTAGTTTTTATACTAAAAGG - Intergenic
993821481 5:92622693-92622715 AATGTCTATTTTATATTATTTGG - Intergenic
993963154 5:94326747-94326769 AAAGTAATTTTTATATCCTAAGG - Intronic
994016316 5:94970502-94970524 AATGTAAGTTGTATATTACTTGG + Intronic
994441300 5:99807836-99807858 AATGTCATTTTTCTATTCTGGGG + Intergenic
994610703 5:102035711-102035733 AATATAATATTTATAATATTTGG - Intergenic
994656889 5:102605467-102605489 AATGTAATTTATATAATGAAAGG - Intergenic
995068903 5:107895038-107895060 ATTATTATTTTTATATTATCAGG + Intronic
995159468 5:108961385-108961407 ATAGCAAATTTTATATTATAAGG - Intronic
995345320 5:111108433-111108455 AATGCAATTTGTATAAAATAGGG - Intronic
995352312 5:111193411-111193433 ACAGTAAGTTTTATTTTATATGG - Intergenic
995352673 5:111198608-111198630 TAAGTAATTTTTATTTTATGAGG + Intergenic
995389233 5:111621612-111621634 AAATGAATTTTTATATTAAATGG + Intergenic
995558230 5:113352914-113352936 AATGTAATTTTAATATGATTTGG + Intronic
995732777 5:115263790-115263812 AATGTAATTCTTATACTCTATGG + Intergenic
995787987 5:115851345-115851367 AGTGGAATTGTTAGATTATATGG + Intronic
996058198 5:119003242-119003264 ATTCTAATTTTTATATTTTTTGG + Intergenic
996075119 5:119183793-119183815 AAATTAAAATTTATATTATATGG - Intronic
996226337 5:121002465-121002487 ATGGTTAATTTTATATTATATGG + Intergenic
996236077 5:121131262-121131284 AATGTAATTTTTAAAAAATGTGG + Intergenic
996283134 5:121756618-121756640 AATGAAAGTTTTCTATTATATGG + Intergenic
996430790 5:123374164-123374186 AATGTAATTTAAAGATTATTTGG + Intronic
996512701 5:124334956-124334978 AATGTAAATCTTATACTAAATGG - Intergenic
996575609 5:124973930-124973952 AATGTAAGTTTTATATGACACGG + Intergenic
996743387 5:126822990-126823012 AAAGTACTTTTTATATTATTAGG + Intronic
996898612 5:128517727-128517749 AGTATAATTTTTAAAATATAAGG + Intronic
996922717 5:128787666-128787688 TCTGTAATTTTTTTATTTTAAGG + Intronic
996933736 5:128923699-128923721 AAAGAAATTATTATAATATATGG - Intronic
996945534 5:129062610-129062632 AATGTAAATATTATTCTATATGG - Intergenic
998123287 5:139597039-139597061 AATGTAATTTTTTTTTTAGATGG - Intronic
998460497 5:142306519-142306541 ACTGTAATGATTATTTTATAAGG + Intergenic
998579567 5:143357786-143357808 ATTGTAATTTGTCTATTTTAAGG + Intronic
998864525 5:146483673-146483695 AACATAGTTTTTAAATTATAAGG + Intronic
999000524 5:147917233-147917255 AAACTAATTTTAATATTAAACGG + Intergenic
999146576 5:149399913-149399935 AATGTAGTTTTTAGCTTACAAGG - Intronic
999479272 5:151930935-151930957 AATGTAAATTTTAAATAAAATGG - Intergenic
999578466 5:153007403-153007425 AATGTATTTTTTATATGAGAAGG + Intergenic
999733705 5:154496545-154496567 AATATAATTTTCATAGTCTAGGG + Intergenic
999792325 5:154953032-154953054 TATGTAGATTTTATCTTATATGG + Intronic
1000035211 5:157442243-157442265 AATATAATATTTATATAATAAGG + Intronic
1000318275 5:160114100-160114122 AAAGTAATTTGTATCTTATTTGG - Intronic
1000348668 5:160335256-160335278 AATGTAATTTTTCTTTTAGATGG - Intronic
1000436565 5:161217821-161217843 AAAGCAATTTTTAAAATATAAGG + Intergenic
1000469609 5:161624070-161624092 AATGGAATTTCTGGATTATAGGG - Intronic
1000646715 5:163768474-163768496 AATGGAATTTTTACATTCTTGGG + Intergenic
1001418643 5:171569367-171569389 AATGTAAAGTTTTGATTATATGG + Intergenic
1002392095 5:178922346-178922368 CATGTAATTTTTGTTCTATATGG + Intronic
1002746379 5:181477353-181477375 AATGTTATTTTTGGATTGTAAGG + Intergenic
1002755074 6:151065-151087 AATGTGATTTTTGGATTGTAAGG - Intergenic
1002881815 6:1259452-1259474 AATGTATTTCTTAAATAATAAGG - Intergenic
1002958748 6:1894367-1894389 ATTTTATGTTTTATATTATAGGG + Intronic
1003108119 6:3230679-3230701 AATATAATTTTAATAGTTTAAGG - Intronic
1004274069 6:14220505-14220527 AATATAATTTTTATGTGACATGG + Intergenic
1004565634 6:16794179-16794201 AATGTATTATTAATATTTTAGGG - Intergenic
1004655941 6:17660786-17660808 AATGGAATTGTTGGATTATAGGG - Intronic
1004846959 6:19654416-19654438 AATTTAACTGTTATATTATATGG + Intergenic
1004969860 6:20897749-20897771 TATTTAAATTTTATATTCTATGG + Intronic
1005162138 6:22876291-22876313 AATGACATTTTTACATTTTATGG - Intergenic
1005250402 6:23939491-23939513 AATCTTATTTATATATTATTGGG + Intergenic
1005372205 6:25145503-25145525 AATGTAACTTTAATATGATGTGG + Intergenic
1005414254 6:25584525-25584547 AATGTAAGTTTTATGTGACATGG + Intronic
1005458156 6:26041733-26041755 AATATAAGTTTTATATTACATGG + Intergenic
1006036943 6:31221375-31221397 AATTTAATTTTTTTCTTATGTGG + Intergenic
1006487566 6:34356241-34356263 AATGTAATTTTTAATTTTTGTGG - Intronic
1007856115 6:44859842-44859864 AATGACATTATTATATTGTAAGG - Intronic
1008182896 6:48355427-48355449 AATTTAATTTTTAATTTTTATGG + Intergenic
1008247112 6:49190375-49190397 AATGTAATATATATATTATAAGG + Intergenic
1008428734 6:51389693-51389715 AATGTCAGTTTTACATTAAATGG - Intergenic
1008778516 6:55071733-55071755 TTTTTAATTTTTATATTACATGG + Intergenic
1008899347 6:56593638-56593660 AATGTTATTTTGATTTTTTAAGG - Intronic
1008982373 6:57499666-57499688 AATTTAAGTTTTATGTGATATGG - Intronic
1009288803 6:61857915-61857937 AATATAAATTTTAAATCATATGG - Intronic
1009382200 6:63045861-63045883 AATTTAATATTTATAAAATATGG + Intergenic
1009480504 6:64152257-64152279 AATATAATGTTTAGATTATGAGG + Intronic
1009579356 6:65512185-65512207 AATGTAATTTTTATACTAAGAGG - Intronic
1009590839 6:65668689-65668711 AAGGTAATCTTTATATTGTATGG - Intronic
1009646891 6:66415560-66415582 CATGTATTTTTTATAGTTTAAGG - Intergenic
1009673965 6:66792782-66792804 AATGTCATTGATATTTTATAGGG - Intergenic
1009858800 6:69298069-69298091 CATGCAATTTTTCTTTTATAAGG - Intronic
1010078856 6:71833251-71833273 AATGTAAATTTTATAGAATTGGG + Intergenic
1010522226 6:76851689-76851711 AGTGAAATTTTTGGATTATATGG - Intergenic
1010527103 6:76914806-76914828 ACAGTAAATTTTATATTATGTGG + Intergenic
1010544580 6:77135929-77135951 TATGAAATTTTTAAAATATACGG + Intergenic
1010689957 6:78898612-78898634 TGTGTAATATTTCTATTATAAGG + Exonic
1010858361 6:80872265-80872287 AATGTAATCTTTGTCTTATGTGG - Intergenic
1010874029 6:81078977-81078999 GATTTAATCTTTATTTTATAGGG + Intergenic
1011351030 6:86423968-86423990 ATTCTAATTTGTATATTTTAGGG + Intergenic
1011573430 6:88765232-88765254 AATGTATATTTTTTATTAGAAGG + Intronic
1011580897 6:88863208-88863230 AATGTTAATTGTATATTAAACGG + Intronic
1011586877 6:88935607-88935629 AATGTCATTGGTATTTTATAGGG + Intronic
1011765368 6:90614031-90614053 AATATAAGTTTTATATGACATGG + Intergenic
1011978057 6:93332538-93332560 AATTTAATTTTTGTGCTATATGG + Intronic
1012180139 6:96142751-96142773 AAAATATTTTTTAAATTATAAGG + Intronic
1012213083 6:96548292-96548314 AATGTATTTTTTCTGTTTTATGG + Intronic
1012250143 6:96970845-96970867 AATGAAATTATTTTATTATAGGG + Intronic
1012311337 6:97727497-97727519 AAAGTAATTTTTATCTTCGATGG + Intergenic
1012537280 6:100313929-100313951 AAAGTGATTTTTATATTTCAAGG - Intergenic
1012670526 6:102040196-102040218 AATTTAATCTTCATATTAAAGGG - Intronic
1012699120 6:102430505-102430527 CAAATAAATTTTATATTATATGG - Intergenic
1012707220 6:102546897-102546919 AAGGAAATATTTATATTATTTGG - Intergenic
1012727637 6:102835396-102835418 AATGTATTTCTTAAATAATAAGG - Intergenic
1013984904 6:116179251-116179273 AATGTAATATTAATAAGATAAGG - Intronic
1014086852 6:117355976-117355998 AAAGTAATTTTAAGAGTATATGG + Intronic
1014258602 6:119189508-119189530 AATGTATATTTTATTTTAAAAGG - Intronic
1014559448 6:122872642-122872664 AATGTATTTTGTATATGAAAAGG + Intergenic
1014606563 6:123481334-123481356 TATGTCATATTTAAATTATAAGG + Intronic
1014797503 6:125743224-125743246 AATAAAATTTTTATACTAAAGGG - Intergenic
1014908723 6:127063310-127063332 AATGTAGTTTTTACACTTTATGG + Intergenic
1015245799 6:131073521-131073543 TAAGTAATTTATATATTAAATGG + Intergenic
1015274481 6:131369831-131369853 AATATAAGTTTTATGTGATATGG + Intergenic
1015296266 6:131597043-131597065 AAAGTAGTTATTATATTTTAGGG - Intronic
1015314355 6:131801404-131801426 AATGTAATTCTAACATTGTATGG + Intergenic
1015439889 6:133235597-133235619 AAAGTAATTTATTTATTACAAGG - Intergenic
1015565159 6:134562617-134562639 AATGTAAATTTCATAATAGAGGG - Intergenic
1015653207 6:135486435-135486457 CTTGTTATTTTTATATTATATGG + Intronic
1015917837 6:138235800-138235822 ATGGTAATTTTTATATTTAATGG + Intronic
1016035618 6:139379962-139379984 AATGAAATGTTTGTATTAAAGGG + Intergenic
1016199123 6:141386302-141386324 AATGTAACTTTTATATTCACTGG - Intergenic
1016339042 6:143041366-143041388 AATCTAAGTTTTATAATGTATGG - Intergenic
1016508270 6:144809924-144809946 AATATAAATTTTACATTATATGG + Intronic
1016574867 6:145558448-145558470 AGTGAAATTGTTAGATTATATGG + Intronic
1016577948 6:145591877-145591899 AAGGTAAAATTAATATTATAAGG + Intronic
1016927306 6:149363675-149363697 AATGATATATTTAAATTATATGG + Intronic
1017049839 6:150380057-150380079 GATGTGACTTTTATACTATAGGG - Intronic
1017294686 6:152779879-152779901 AATGTAGTTTCTGGATTATATGG + Intergenic
1017332286 6:153213818-153213840 AATTTACTTATTATTTTATAAGG + Intergenic
1017396585 6:154007378-154007400 AAAGTAATCTTAAGATTATATGG + Intergenic
1017589576 6:155964265-155964287 AATGTAATTCAAATATCATATGG + Intergenic
1017600178 6:156071799-156071821 AATGCAATTTTTAGGTTATGGGG - Intergenic
1017603815 6:156111911-156111933 AATGTAATGTATTTAATATATGG - Intergenic
1017776572 6:157685551-157685573 AATATAATTTTTAAATTACTGGG + Intergenic
1017938939 6:159033992-159034014 CATGAAATTTATATATTATTGGG + Intergenic
1017955604 6:159175125-159175147 ATTGTACTTTATAGATTATAAGG - Intronic
1018265115 6:162016076-162016098 AAAGTCAGTTTTATGTTATAGGG + Intronic
1018405382 6:163476200-163476222 AAATAAATTTTTATACTATACGG + Intronic
1018492362 6:164307123-164307145 AATATAATTTTCATAGTATCTGG - Intergenic
1018664655 6:166124442-166124464 AGTCTACTTTTTATAATATATGG - Intergenic
1018919960 6:168165530-168165552 TATGTCATTTTTATTTTATGAGG + Intergenic
1018960757 6:168446824-168446846 AATGAAAATTTTATAATATCTGG + Intronic
1019111655 6:169722263-169722285 AATGAAATGCTTATTTTATAAGG - Intronic
1019235259 6:170606664-170606686 AATGTGATTTTTGGATTGTAAGG + Intergenic
1020384505 7:7583594-7583616 AATGTTAGTATAATATTATAAGG + Intronic
1020427407 7:8084674-8084696 AATGTCCTTTTTATGTTCTATGG + Intronic
1020750921 7:12141154-12141176 AATGTACTTTATAAATTATGAGG - Intergenic
1020888271 7:13846749-13846771 AATGTAAGTTTTACATGACATGG - Intergenic
1020961761 7:14813629-14813651 TATGTAATTTTTCTATTAAATGG - Intronic
1021111092 7:16695530-16695552 AATATAGCTTTTACATTATAGGG - Intronic
1021256961 7:18404323-18404345 AATGTAATGTTTTTTTTAAAGGG + Intronic
1021778991 7:24083235-24083257 AATGTAATTTATATATAAATAGG - Intergenic
1021972009 7:25974247-25974269 AATGTACTTTTTGAATTGTAAGG - Intergenic
1022072404 7:26929956-26929978 AATTCAATTTTTATATAAGATGG - Intronic
1022240333 7:28505107-28505129 AAAATAATTTTTACATAATATGG + Intronic
1022295409 7:29046718-29046740 AATGTAAATTCTATATCACAAGG + Intronic
1022417196 7:30188636-30188658 ATTGTAATTTTTATGTTTTGGGG - Intergenic
1022692960 7:32675974-32675996 GCTGTAATTTTTATTTTAAATGG - Intergenic
1022920632 7:35010510-35010532 GCTGTAATTTTTATTTTAAATGG - Exonic
1023161916 7:37305347-37305369 ATGGTTATTTGTATATTATAAGG + Intronic
1023167504 7:37357234-37357256 AATATAAGTTTTATATAACATGG - Intronic
1023210638 7:37800733-37800755 AATTTAAATTTTACATGATATGG + Intronic
1023271109 7:38463585-38463607 ATTGTAACTTTTATATTAAAAGG + Intronic
1023477540 7:40597184-40597206 AATCTGATTTTTATATGTTAAGG - Intronic
1023506847 7:40908650-40908672 TTTATATTTTTTATATTATATGG - Intergenic
1023709040 7:42972332-42972354 ATTGTAAGTTTTATTTTAAATGG + Intergenic
1024111941 7:46155939-46155961 AATGAAATGTTTAAATTATGAGG - Intergenic
1024217298 7:47258243-47258265 AATGTAAGTTTTACTTTACAGGG + Intergenic
1024340289 7:48250658-48250680 TTTGTAATATTTATATTTTAGGG - Intronic
1024399205 7:48904391-48904413 AATGATATTTTTAAATTAGATGG - Intergenic
1024526162 7:50351162-50351184 AATGCAGTTTTTATAATATGGGG + Intronic
1024685679 7:51742576-51742598 AATCTAATTTTTTTATTATAAGG - Intergenic
1024901661 7:54324733-54324755 AATGTCCTTTTTCTGTTATAGGG - Intergenic
1024961107 7:54977715-54977737 AATTGAATTGTTGTATTATAGGG - Intergenic
1025741453 7:64200375-64200397 AATGTCATTTTTGTACTTTAGGG + Intronic
1025756313 7:64346875-64346897 GATGTAATTTTGATTTTCTAGGG + Intronic
1025954554 7:66172413-66172435 AATTTAATTTTTTTTTTAGATGG - Intergenic
1027469049 7:78550936-78550958 AAATTGATTTTTTTATTATATGG + Intronic
1027510745 7:79076786-79076808 AATGTAAATTTTATTTTTAAAGG + Intronic
1027565559 7:79788460-79788482 AATGTAATGTTAATGTTTTAGGG - Intergenic
1027573567 7:79903035-79903057 AATGTATTTCTTACATAATAAGG - Intergenic
1027660599 7:80983913-80983935 AATTGAATTTTTATAAAATAGGG - Intergenic
1027735105 7:81921916-81921938 ATTGTAATTTATATATTAAATGG - Intergenic
1027801110 7:82750193-82750215 AATGAAATTATTCAATTATAAGG + Intergenic
1027812174 7:82917176-82917198 AATGTAATTTAAATTTTAGATGG - Intronic
1027817655 7:82997543-82997565 TAAGTAATTTATAGATTATAGGG - Intronic
1028059343 7:86291511-86291533 CATATAATTTTTATATTTTGTGG - Intergenic
1028203288 7:87987588-87987610 AATGTAATTTGTTTATGATATGG + Intronic
1028410717 7:90527740-90527762 ATAGTACTTTGTATATTATAGGG - Intronic
1028438050 7:90827955-90827977 AATGTGATTTTTAAATTGAAAGG - Intronic
1028462403 7:91109944-91109966 AATTTTTGTTTTATATTATAAGG - Intronic
1028478782 7:91281518-91281540 AATCTTATTTTTAAATTTTATGG - Intergenic
1028495740 7:91457975-91457997 AATGTAATTTTTATGTGGTTGGG - Intergenic
1028558928 7:92152381-92152403 AATGTCATTTATGTATTAAATGG - Intronic
1028633867 7:92965584-92965606 AATGTAAATTTTTTTTTAAAAGG + Intergenic
1028695813 7:93710345-93710367 AATGTAATTATTTTATTGTCAGG + Intronic
1028795898 7:94903713-94903735 AATGTAAATTTTGTATAAAATGG + Intergenic
1028811571 7:95093668-95093690 AAATTAATTTTTGTATCATATGG - Intronic
1028873288 7:95792638-95792660 AATGTAAGTTTTACATGGTATGG - Intronic
1029049057 7:97664359-97664381 AATATAATTTCTAGATCATACGG + Intergenic
1030465440 7:109896126-109896148 CATATAATTTTTATGTTTTAAGG + Intergenic
1030649818 7:112105327-112105349 AATGTACTTTTTATTTTTAAAGG - Intronic
1030805327 7:113910998-113911020 AATTGAATTTTAATATTGTAAGG - Intronic
1031095349 7:117411874-117411896 AATTTTATTCTTATTTTATATGG - Intronic
1031166459 7:118234096-118234118 AATATAATTTCTAAATTTTATGG + Intronic
1031205566 7:118752763-118752785 TATGCAATTTCTTTATTATAAGG - Intergenic
1031232759 7:119130556-119130578 AAAGTAAATCTTATATTCTAAGG - Intergenic
1031654774 7:124341121-124341143 AATGTATTTCTTAAATAATAAGG + Intergenic
1031682665 7:124693716-124693738 TATGAAGTTTTTAAATTATAGGG + Intergenic
1032778889 7:135145853-135145875 AAAGTCATGTTTATACTATAAGG + Intronic
1032967384 7:137115386-137115408 CAAGTAATGTTTATTTTATAAGG - Intergenic
1033092406 7:138398163-138398185 CAAATAATTTTTTTATTATATGG - Intergenic
1033201360 7:139373989-139374011 AATGAAATTTTTTTCTTAAATGG + Intronic
1033389718 7:140915121-140915143 GATGTATTTTTAATATTAAAGGG - Intronic
1033390301 7:140921200-140921222 AATGTATTTATTATACCATATGG + Intronic
1033424564 7:141232285-141232307 AATATAAATCTTCTATTATAAGG - Intronic
1033496824 7:141907394-141907416 AGTGGAATTTTTCCATTATAGGG + Intergenic
1033734682 7:144209827-144209849 TATGTATTTTTTAATTTATATGG + Intergenic
1033748371 7:144341142-144341164 TATGTATTTTTTAATTTATATGG - Intergenic
1033867497 7:145710255-145710277 AATATATTTTTTAAAATATACGG + Intergenic
1034013968 7:147561860-147561882 AATGTAATTTTTATTTTACTGGG - Intronic
1034032010 7:147777690-147777712 CATTTAATGTTTGTATTATAAGG + Intronic
1034117368 7:148595207-148595229 TATATAATATCTATATTATATGG + Intronic
1034380545 7:150688547-150688569 AATGTAAGTTTGATGTTAGACGG - Intronic
1034602901 7:152279971-152279993 AATGCCATTAATATATTATATGG + Intronic
1034758144 7:153642303-153642325 AATGTAATTTTTTTTTGAGATGG - Intergenic
1035447748 7:158954483-158954505 CATCTAATTTTTATATTTTTAGG - Intronic
1035496756 7:159334452-159334474 AATGTGATTTTTGGATTGTAAGG + Intergenic
1035513332 8:209321-209343 AATGTTATTTTTGGATTGTAAGG - Intergenic
1035517057 8:243336-243358 AAAGTAATTATTCTATCATAGGG + Intronic
1036040208 8:5070042-5070064 GATGTACTTGTTATATTATTGGG + Intergenic
1036977879 8:13434986-13435008 AATGTATTTCTTAAATAATAAGG - Intronic
1037018710 8:13941451-13941473 AGTAAAATTTTTATATTATTGGG + Intergenic
1037285857 8:17299608-17299630 AATATAATTTTCATAGTCTAGGG + Exonic
1038715448 8:29986965-29986987 ATTGTCATTTTTATTTTATTGGG - Intergenic
1038770469 8:30474390-30474412 AAGCTAATATTTAAATTATATGG + Intronic
1038774485 8:30516071-30516093 AATGTTAATTTTAAATTATTAGG - Intronic
1039153901 8:34533884-34533906 AATGTAAATTGTATATTCAAGGG - Intergenic
1039295864 8:36153667-36153689 AATGGAATTTTAAGATTCTAAGG - Intergenic
1039358285 8:36845667-36845689 AAGGTAATTTTATTATTTTATGG + Exonic
1039661045 8:39466055-39466077 AATTTAAAATTTATATTAAATGG - Intergenic
1040077329 8:43250221-43250243 TATTTAATTTTTATAATAAATGG + Intergenic
1040644618 8:49383796-49383818 AATGTAAGTTTTGTTTCATAAGG - Intergenic
1040705801 8:50125563-50125585 AATGTAATTTTTATATACTAAGG + Intronic
1040801553 8:51347252-51347274 AATTTAATTTACATATGATAAGG - Intronic
1040961113 8:53034270-53034292 TATGTAAATATTATTTTATAGGG - Intergenic
1041131200 8:54703238-54703260 AATGTATTTCTTAAATAATAAGG + Intergenic
1041230395 8:55745007-55745029 AATGTAATTTTTAAAATATTTGG - Intronic
1041385239 8:57294711-57294733 TATTTAATTTTTATAATAAATGG + Intergenic
1041587713 8:59541474-59541496 AATATAAGTTTTATGTGATATGG + Intergenic
1041744684 8:61195600-61195622 AAGCTAATTTTTTTATGATATGG - Intronic
1041940877 8:63386403-63386425 AATGTAATTTACATAGTATCAGG - Intergenic
1042576918 8:70231079-70231101 AATGTAATTATTAGATCAAAGGG + Intronic
1042641559 8:70940990-70941012 AATGTTAATTTTATGTTATGTGG - Intergenic
1043292045 8:78614171-78614193 AATCAAATATTTATATTAGAGGG + Intergenic
1043293943 8:78640820-78640842 AATTTAATTTTTAATTTTTATGG + Intergenic
1043334312 8:79155167-79155189 AATGAAATTATTATAACATATGG + Intergenic
1043406938 8:79946112-79946134 AATGGAATTGGTATTTTATATGG - Intronic
1043528990 8:81129167-81129189 AATATCAGTTTTATAGTATATGG - Intergenic
1043650903 8:82590620-82590642 AATGTTATTTTAAGATTAAAGGG + Intergenic
1043755837 8:84001810-84001832 AATCTTACTTTTATCTTATAAGG + Intergenic
1043864845 8:85363011-85363033 AATGTGAGTTTTATTTTATAAGG + Intronic
1044323635 8:90834667-90834689 TATGTACTGTTTATATTATTTGG - Intronic
1044634799 8:94311596-94311618 AATGTAATGTTTATGCTCTATGG + Intergenic
1044767798 8:95595459-95595481 AATATAAGGATTATATTATAAGG - Intergenic
1044791482 8:95851955-95851977 AATGTATTTTCTATTTTTTAGGG + Intergenic
1044917902 8:97135562-97135584 AATGTATTTTTAGTATTTTAAGG + Intronic
1045372935 8:101543163-101543185 CATGTAATATGTATATTATTAGG + Intronic
1045452318 8:102339777-102339799 AATGAAGTTTTTTTTTTATACGG - Intronic
1045623974 8:104020062-104020084 AAAATCATTTTTATAGTATATGG - Intronic
1045631239 8:104125838-104125860 AATCTAATTTTTATATTTGCGGG + Intronic
1045639216 8:104229060-104229082 AATTTTACTTTTATATTAAAGGG - Intronic
1045723357 8:105140349-105140371 AATTTAATTACTATAATATAGGG + Intronic
1045952682 8:107869069-107869091 AATGTAATATTTAATTTGTAAGG - Intergenic
1046036779 8:108852481-108852503 AATGTGATTGATATTTTATAGGG - Intergenic
1046140215 8:110081836-110081858 TATAAAATTTTTCTATTATAAGG - Intergenic
1046280677 8:112025882-112025904 AATGTGATTTTTGTATGAAAAGG + Intergenic
1046319476 8:112553340-112553362 AATTAAAATTTTATATTTTAGGG + Intronic
1046460057 8:114521763-114521785 CATTTAATTATTATTTTATATGG + Intergenic
1047030343 8:120871522-120871544 AATTTAATTTTTTGAATATAAGG + Intergenic
1047169165 8:122474089-122474111 AATGTATTTTTTTCTTTATATGG + Intergenic
1047842501 8:128767858-128767880 AATGTAATCTTTATCTTTTAGGG - Intergenic
1047919803 8:129623171-129623193 AATATAAATTATATATTATGAGG + Intergenic
1048512103 8:135072197-135072219 AAAGTACTTTATATATTATAAGG + Intergenic
1050289196 9:4136533-4136555 AATGTACTTTAAATATTATTTGG - Intronic
1050717463 9:8546205-8546227 AAATCAGTTTTTATATTATATGG - Intronic
1050846100 9:10221341-10221363 GATATCATTTTTATATGATATGG + Intronic
1050897659 9:10903360-10903382 TATGTAATTTTGTTATTATTAGG + Intergenic
1051005846 9:12342768-12342790 AATGTACTTTTAAAAATATAAGG + Intergenic
1051015576 9:12471468-12471490 AATGTAATTTTTTTTTTAGATGG + Intergenic
1051467758 9:17400000-17400022 AATATAAGTTTTACATGATAAGG - Intronic
1051474653 9:17492203-17492225 AATTTAATTATTTTATTAAAAGG - Intronic
1051668959 9:19491539-19491561 AATGTAATTTTTTTTTTTTTTGG + Intergenic
1051763170 9:20491485-20491507 AATCTAATATTTATTTTATGAGG + Intronic
1051810454 9:21042965-21042987 AATGGAATTGTTGAATTATAGGG + Intergenic
1051975617 9:22943903-22943925 AATATTATTTTTATATTAAAGGG - Intergenic
1052085994 9:24266675-24266697 AATGTAGTTTTTTAAATATACGG - Intergenic
1052154163 9:25163012-25163034 AATGTAATTTTCATCTTTTTGGG + Intergenic
1052458749 9:28735305-28735327 AATATAATTTTTAAAATTTATGG - Intergenic
1052599305 9:30604061-30604083 ATTCTAAGTTTTTTATTATAGGG + Intergenic
1053130777 9:35614119-35614141 ATTTTTATTTTTATATTATGAGG + Intronic
1053170856 9:35881719-35881741 AATTTAACTTTTATTTTATCTGG + Intergenic
1053502148 9:38606741-38606763 TATTTAATTTTTATAGTAAATGG - Intergenic
1053535455 9:38921191-38921213 AATGAAATTCTGATATTTTAGGG - Intergenic
1053579338 9:39387400-39387422 AATAAAATTTCAATATTATAAGG - Intergenic
1053746528 9:41204085-41204107 AAGGTATGTTTTATATAATAAGG + Intergenic
1053892865 9:42712368-42712390 AATGTATTTTTTATTTTTTGTGG + Intergenic
1054100923 9:60946206-60946228 AATAAAATTTCAATATTATAAGG - Intergenic
1054122300 9:61221580-61221602 AATAAAATTTCAATATTATAAGG - Intergenic
1054207675 9:62145595-62145617 AATGAAATTCTGATATTTTAGGG - Intergenic
1054480737 9:65661137-65661159 AAGGTATGTTTTATATAATAAGG - Intergenic
1054585428 9:66960676-66960698 AATAAAATTTCAATATTATAAGG + Intergenic
1054681817 9:68227193-68227215 AAGGTATGTTTTATATAATAAGG - Intergenic
1054830456 9:69619252-69619274 AAAGTAATCTGTATATTATGGGG - Intronic
1055032128 9:71781049-71781071 AAAGTCATTTTTATACTAGAAGG - Intronic
1055394474 9:75859396-75859418 AATGTATTTGTTAAATTTTAAGG + Intergenic
1055420183 9:76131881-76131903 AATGTTATTTTTAAATTACTAGG + Intronic
1055676638 9:78669562-78669584 AATATAATTTTTATTTTCTCAGG - Intergenic
1055770253 9:79709145-79709167 AATGTAATTTATATAATCTAAGG + Intronic
1055821166 9:80266196-80266218 AAAGTTATTTGAATATTATAAGG + Intergenic
1055824748 9:80310195-80310217 AATGTGATTTTGTTTTTATATGG - Intergenic
1056003768 9:82244989-82245011 AATGTAATTGGTATTTCATAGGG + Intergenic
1056024051 9:82474033-82474055 AATGGAATTGCTATATTGTATGG - Intergenic
1056169757 9:83973067-83973089 AATGAAGTTTTTATATTGTGGGG - Intronic
1056288475 9:85115464-85115486 AAGGAAATTGATATATTATAGGG - Intergenic
1056310507 9:85336045-85336067 AATGGAATTTTTATTTTAGAGGG - Intergenic
1056707777 9:88966730-88966752 AATTTAATTTTTTTTTTAAAGGG + Intergenic
1056898116 9:90570184-90570206 AATGGAATTTCTTGATTATAGGG - Intergenic
1057029609 9:91765425-91765447 TGTGTAATTTTTTTATTGTAAGG + Intronic
1057153946 9:92822938-92822960 TATTTAATTTTTATAGTAAATGG + Intergenic
1057418839 9:94891402-94891424 AATGTAATTATGATATGCTAGGG + Intronic
1057681519 9:97191051-97191073 TATTTAATTTTTATAGTAAATGG - Intergenic
1058003090 9:99886940-99886962 AATGTAAGTTTCAAATGATAAGG + Intergenic
1058159683 9:101555305-101555327 TATGTGATTTATATATAATAAGG + Intronic
1058196453 9:101983075-101983097 AATGTAACTTTTATATGCAATGG + Intergenic
1059016444 9:110521534-110521556 AAAGTAATTTTTATATGTTGGGG + Intronic
1059030555 9:110689652-110689674 AATATACTATGTATATTATATGG - Intronic
1059198259 9:112391303-112391325 AATTTAATTTTTTTATTTTTTGG - Intronic
1059210098 9:112506070-112506092 AAAGTAATTTTTGAACTATAGGG + Intronic
1059628684 9:116095845-116095867 AAAATAATATTTACATTATAAGG + Intergenic
1059797075 9:117709524-117709546 AATGTCATCTTGATATTTTAGGG + Intronic
1059861389 9:118467154-118467176 AATTACATATTTATATTATAGGG + Intergenic
1059977128 9:119729503-119729525 AATGCAAGTTTTATTTTCTATGG + Intergenic
1060067595 9:120516659-120516681 AATTTAATTTTTATTTTTTGTGG - Intronic
1060460029 9:123843317-123843339 CATGTAATTTTTGTTCTATATGG + Intronic
1202782658 9_KI270718v1_random:14860-14882 AAGGTATGTTTTATATAATAAGG + Intergenic
1203731096 Un_GL000216v2:90725-90747 TATGTATATTTTATAGTATATGG - Intergenic
1186134089 X:6500696-6500718 ATTGTAATTACTATATCATAGGG + Intergenic
1186162533 X:6792749-6792771 AATGTAAGTTTTACATGACATGG - Intergenic
1186269485 X:7869852-7869874 AAAATTATTTTTATATTGTATGG + Intergenic
1186369492 X:8931979-8932001 AATGTAATTTTTAAACTATTTGG + Intergenic
1186739373 X:12500914-12500936 AATATAATTTTTAAAAGATATGG + Intronic
1186800614 X:13088801-13088823 AATTTATTTTTTATTTTTTATGG - Intergenic
1187074913 X:15924937-15924959 AATGTATTTCTTAAATAATAAGG - Intergenic
1187195973 X:17083922-17083944 AAGGTGAATTTTATAGTATATGG - Intronic
1187508937 X:19900235-19900257 AATGTATTTTTTAAGTTAAAAGG - Intergenic
1187672481 X:21682217-21682239 AATGTAACTATTATATAATTGGG - Intergenic
1188058633 X:25572892-25572914 AATGTAAGATTAAAATTATATGG - Intergenic
1188164387 X:26843972-26843994 CATTTATTTTATATATTATATGG - Intergenic
1188224689 X:27582815-27582837 TATGTAATTTTTTTAAAATATGG - Intergenic
1188266149 X:28077746-28077768 TAGGTAATTTTTAAACTATAAGG + Intergenic
1188318805 X:28709820-28709842 CATGTACTTTTTAAATTTTAAGG - Intronic
1188423503 X:30017572-30017594 CATGTAATTTTTGTTCTATATGG - Intergenic
1188708327 X:33363018-33363040 AAAGTAATTATTACATTAGAGGG + Intergenic
1188720042 X:33510986-33511008 ATTGTAATTTTTAATTTTTATGG + Intergenic
1188783020 X:34308510-34308532 AAAGGAATTTTTAGATCATATGG - Intergenic
1188836590 X:34964260-34964282 ATTTTAATTTTGATAATATAAGG + Intergenic
1188900391 X:35725404-35725426 AAAGTTATTTTTATATCAGAAGG + Intergenic
1189087660 X:38043284-38043306 ACTTTAATGTTCATATTATATGG - Intronic
1189087672 X:38043554-38043576 ACTTTAATGTTCATATTATATGG - Intronic
1189139707 X:38589650-38589672 TATATACCTTTTATATTATAAGG + Intronic
1189357514 X:40322424-40322446 AATGTAATTTTTATTTTAGGTGG - Intergenic
1189528236 X:41849694-41849716 ATCATAATTTTTATTTTATAGGG - Intronic
1189766209 X:44374928-44374950 AATGTAAGTTTTATGTGACATGG - Intergenic
1189831353 X:44976848-44976870 AATGGAATTGTTGGATTATAGGG + Intronic
1189950398 X:46224214-46224236 AATGTGATTTTGCTATTATTGGG - Intergenic
1190035778 X:47022391-47022413 ATTTTAATTTTTCTACTATATGG - Intronic
1190100596 X:47520063-47520085 AATGAAATTGTTGGATTATATGG - Intergenic
1190144998 X:47882648-47882670 AATGGAATTGCTAAATTATATGG + Intronic
1190444515 X:50510137-50510159 CTTGTAATTTTTATATTTGATGG + Intergenic
1190728680 X:53210002-53210024 AATGTAATTCTTATTTTGGATGG - Intronic
1191078066 X:56477277-56477299 AATCTAATTTTTAAATTAAAGGG - Intergenic
1191086459 X:56572831-56572853 AAGGTAATTTATTTAATATAAGG - Intergenic
1192193043 X:69006132-69006154 AATGCAATTGTTGTATTGTATGG + Intergenic
1192386618 X:70678527-70678549 AATGTAATTTTTTTAACATGAGG - Intronic
1192405689 X:70883837-70883859 AATGTTTATTTTCTATTATACGG - Intronic
1192690875 X:73362283-73362305 TATGGAATTTTTATAGTATTAGG + Intergenic
1193169358 X:78317961-78317983 AATTTAATTTTAATAGTATTGGG - Intronic
1193624517 X:83800786-83800808 TCTGTAATTTACATATTATATGG + Intergenic
1193652110 X:84149454-84149476 AATGTATTTCTTAAATAATAGGG + Intronic
1193950325 X:87789113-87789135 AAAGTCATTTTTATATTTTTGGG + Intergenic
1194175292 X:90638874-90638896 AACTTAATTTCTATCTTATAGGG + Intergenic
1194249065 X:91551223-91551245 AAGGTTATTCTTAAATTATATGG + Intergenic
1194358000 X:92912047-92912069 AGTGAAATTGCTATATTATATGG - Intergenic
1194450061 X:94033903-94033925 AAAGTATTTCTTATATTATTAGG + Intergenic
1194678854 X:96826993-96827015 AATTTAATGTTTAAATTATTTGG + Intronic
1194725809 X:97395633-97395655 AATGTAATTATTTTAGTATGGGG - Intronic
1194762450 X:97810711-97810733 AATATTATTTTTATATATTAAGG - Intergenic
1194998347 X:100616642-100616664 AATGTAATTTTAATAGTATATGG - Intergenic
1195223704 X:102770744-102770766 AATGTATATTTTATTATATATGG + Intergenic
1195253800 X:103074379-103074401 AATGTATTTTTCACATTAGATGG + Intergenic
1195266055 X:103180977-103180999 AATGTAATTTTTCAAATATTTGG + Intergenic
1195585371 X:106559288-106559310 AATGTACTTTTTCAATTATAAGG + Intergenic
1195641607 X:107181706-107181728 AATGACATCTTTATCTTATAGGG + Intronic
1196017229 X:110952839-110952861 AATTTAATAATTATATTATCTGG - Intronic
1196202999 X:112907369-112907391 AACGTAATTTTTATTTTGTTAGG + Intergenic
1196306860 X:114113114-114113136 AATACAATTTTTATTTTCTAAGG + Intergenic
1196401895 X:115325494-115325516 GATATAATTCTTATACTATAAGG + Intergenic
1196477548 X:116106311-116106333 AATGTCATTCCTATATTTTAAGG + Intergenic
1196610956 X:117714317-117714339 AATTATATTTTTATATTATGTGG - Intergenic
1197079215 X:122392679-122392701 TTTGTAAGTTTTATTTTATAAGG - Intergenic
1197271480 X:124429059-124429081 CAGGTAATTTTTATATTAAGTGG - Intronic
1197336731 X:125218191-125218213 AATGTAATGTTTCCATTTTAAGG - Intergenic
1197476551 X:126931680-126931702 AATGTCATTGGTATTTTATAGGG + Intergenic
1197558242 X:127984304-127984326 AATGGAATTGCTAAATTATATGG + Intergenic
1198050599 X:132949357-132949379 ATTTTAATTTATAAATTATATGG - Intronic
1198632585 X:138657338-138657360 AATGTTATTTTAATAATAGATGG - Intronic
1198663113 X:138992575-138992597 AAGGTATTTATTTTATTATATGG - Intronic
1198774110 X:140161484-140161506 TATGTAATTTTCATAAAATATGG + Intergenic
1199048340 X:143204548-143204570 AAAGTAATGTGTAAATTATAAGG - Intergenic
1199146230 X:144370888-144370910 AGTGGAATTTCTAGATTATATGG + Intergenic
1199518205 X:148703250-148703272 AAAGTTATTTTCATATTACAGGG + Intronic
1199525599 X:148788416-148788438 AATGCAAATTTTATATTAATGGG - Intronic
1199701792 X:150384134-150384156 AATGGAATTTTTGCATCATATGG + Intronic
1199948956 X:152690169-152690191 AATGTATTTTTGCTATTAGAGGG - Intergenic
1199960720 X:152778280-152778302 AATGTATTTTTGCTATTAGAGGG + Intergenic
1200666179 Y:6027698-6027720 AGTGAAATTGCTATATTATATGG - Intergenic
1201327993 Y:12786355-12786377 AATGTAATTTTTATATTATACGG + Intronic
1201376352 Y:13324939-13324961 AATGTAATTTTTAAAAGAGAGGG - Intronic
1201390478 Y:13491941-13491963 AATATGATTTTTATATTAATTGG + Intergenic
1201450864 Y:14112985-14113007 AAAATAATTTTTATATTGTGTGG - Intergenic
1201526750 Y:14944538-14944560 CATTTGATATTTATATTATAAGG - Intergenic
1201537130 Y:15062652-15062674 TATGTAATCTTTGTAATATAGGG - Intergenic
1201617453 Y:15917204-15917226 ATTGTAATTAATATATCATATGG + Intergenic
1201760041 Y:17526992-17527014 AAATTAATTTTTAATTTATAAGG - Intergenic
1201841513 Y:18378998-18379020 AAATTAATTTTTAATTTATAAGG + Intergenic