ID: 1201337678

View in Genome Browser
Species Human (GRCh38)
Location Y:12897828-12897850
Sequence TATGATGTGGTGAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201337673_1201337678 7 Left 1201337673 Y:12897798-12897820 CCTTGAGAAATCAGGGCTTAATA No data
Right 1201337678 Y:12897828-12897850 TATGATGTGGTGAGGGTGGAAGG No data
1201337670_1201337678 20 Left 1201337670 Y:12897785-12897807 CCAACATTCGTCTCCTTGAGAAA No data
Right 1201337678 Y:12897828-12897850 TATGATGTGGTGAGGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201337678 Original CRISPR TATGATGTGGTGAGGGTGGA AGG Intergenic
No off target data available for this crispr