ID: 1201337689

View in Genome Browser
Species Human (GRCh38)
Location Y:12897932-12897954
Sequence ATGTTCTTACAGCTGAAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201337682_1201337689 25 Left 1201337682 Y:12897884-12897906 CCATAAACTCTCTAGCCTCAGTG No data
Right 1201337689 Y:12897932-12897954 ATGTTCTTACAGCTGAAGTAGGG No data
1201337684_1201337689 10 Left 1201337684 Y:12897899-12897921 CCTCAGTGGTAATGCAAAATAGG No data
Right 1201337689 Y:12897932-12897954 ATGTTCTTACAGCTGAAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201337689 Original CRISPR ATGTTCTTACAGCTGAAGTA GGG Intergenic
No off target data available for this crispr