ID: 1201338167

View in Genome Browser
Species Human (GRCh38)
Location Y:12903083-12903105
Sequence CAGTGTTCCCAGAGTGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201338167_1201338169 28 Left 1201338167 Y:12903083-12903105 CCAACTTCACTCTGGGAACACTG No data
Right 1201338169 Y:12903134-12903156 GAATGTTTTAATTTTAAATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201338167 Original CRISPR CAGTGTTCCCAGAGTGAAGT TGG (reversed) Intergenic
No off target data available for this crispr