ID: 1201338417

View in Genome Browser
Species Human (GRCh38)
Location Y:12904927-12904949
Sequence CTCTTCAGGGATGAGTCATG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 4, 1: 0, 2: 0, 3: 13, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201338412_1201338417 6 Left 1201338412 Y:12904898-12904920 CCTACAGTGGACTACCCGATTTT 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1201338417 Y:12904927-12904949 CTCTTCAGGGATGAGTCATGTGG 0: 4
1: 0
2: 0
3: 13
4: 146
1201338413_1201338417 -8 Left 1201338413 Y:12904912-12904934 CCCGATTTTTCGCTTCTCTTCAG 0: 1
1: 0
2: 1
3: 16
4: 294
Right 1201338417 Y:12904927-12904949 CTCTTCAGGGATGAGTCATGTGG 0: 4
1: 0
2: 0
3: 13
4: 146
1201338414_1201338417 -9 Left 1201338414 Y:12904913-12904935 CCGATTTTTCGCTTCTCTTCAGG 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1201338417 Y:12904927-12904949 CTCTTCAGGGATGAGTCATGTGG 0: 4
1: 0
2: 0
3: 13
4: 146
1201338410_1201338417 24 Left 1201338410 Y:12904880-12904902 CCGCTATTCGGTCTCACACCTAC 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1201338417 Y:12904927-12904949 CTCTTCAGGGATGAGTCATGTGG 0: 4
1: 0
2: 0
3: 13
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201338417 Original CRISPR CTCTTCAGGGATGAGTCATG TGG Exonic