ID: 1201346827

View in Genome Browser
Species Human (GRCh38)
Location Y:12993881-12993903
Sequence CCTACATGTGATGTTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201346827_1201346831 -8 Left 1201346827 Y:12993881-12993903 CCAGCCTCAACATCACATGTAGG No data
Right 1201346831 Y:12993896-12993918 CATGTAGGGTACCCAAAGTCTGG No data
1201346827_1201346836 20 Left 1201346827 Y:12993881-12993903 CCAGCCTCAACATCACATGTAGG No data
Right 1201346836 Y:12993924-12993946 ATGTAGGAATGAGAAGAGACAGG No data
1201346827_1201346835 4 Left 1201346827 Y:12993881-12993903 CCAGCCTCAACATCACATGTAGG No data
Right 1201346835 Y:12993908-12993930 CCAAAGTCTGGTGGCGATGTAGG No data
1201346827_1201346832 -5 Left 1201346827 Y:12993881-12993903 CCAGCCTCAACATCACATGTAGG No data
Right 1201346832 Y:12993899-12993921 GTAGGGTACCCAAAGTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201346827 Original CRISPR CCTACATGTGATGTTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr