ID: 1201346831

View in Genome Browser
Species Human (GRCh38)
Location Y:12993896-12993918
Sequence CATGTAGGGTACCCAAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201346827_1201346831 -8 Left 1201346827 Y:12993881-12993903 CCAGCCTCAACATCACATGTAGG No data
Right 1201346831 Y:12993896-12993918 CATGTAGGGTACCCAAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201346831 Original CRISPR CATGTAGGGTACCCAAAGTC TGG Intergenic
No off target data available for this crispr