ID: 1201349663

View in Genome Browser
Species Human (GRCh38)
Location Y:13025825-13025847
Sequence AAGAAGGAAAAGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201349663_1201349672 15 Left 1201349663 Y:13025825-13025847 CCTCCTTCCCTCTTTTCCTTCTT No data
Right 1201349672 Y:13025863-13025885 GAACTCCAGAGTGTCTATGTTGG No data
1201349663_1201349668 -7 Left 1201349663 Y:13025825-13025847 CCTCCTTCCCTCTTTTCCTTCTT No data
Right 1201349668 Y:13025841-13025863 CCTTCTTTCCTTCCTTCCTCTGG No data
1201349663_1201349676 29 Left 1201349663 Y:13025825-13025847 CCTCCTTCCCTCTTTTCCTTCTT No data
Right 1201349676 Y:13025877-13025899 CTATGTTGGTCTGCCTGATGGGG No data
1201349663_1201349674 27 Left 1201349663 Y:13025825-13025847 CCTCCTTCCCTCTTTTCCTTCTT No data
Right 1201349674 Y:13025875-13025897 GTCTATGTTGGTCTGCCTGATGG No data
1201349663_1201349675 28 Left 1201349663 Y:13025825-13025847 CCTCCTTCCCTCTTTTCCTTCTT No data
Right 1201349675 Y:13025876-13025898 TCTATGTTGGTCTGCCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201349663 Original CRISPR AAGAAGGAAAAGAGGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr