ID: 1201349668

View in Genome Browser
Species Human (GRCh38)
Location Y:13025841-13025863
Sequence CCTTCTTTCCTTCCTTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201349656_1201349668 23 Left 1201349656 Y:13025795-13025817 CCATTATTTCTTCAAATAATCCC No data
Right 1201349668 Y:13025841-13025863 CCTTCTTTCCTTCCTTCCTCTGG No data
1201349662_1201349668 -6 Left 1201349662 Y:13025824-13025846 CCCTCCTTCCCTCTTTTCCTTCT 0: 3
1: 51
2: 710
3: 5926
4: 25288
Right 1201349668 Y:13025841-13025863 CCTTCTTTCCTTCCTTCCTCTGG No data
1201349659_1201349668 1 Left 1201349659 Y:13025817-13025839 CCCCACTCCCTCCTTCCCTCTTT 0: 2
1: 32
2: 568
3: 4269
4: 17294
Right 1201349668 Y:13025841-13025863 CCTTCTTTCCTTCCTTCCTCTGG No data
1201349663_1201349668 -7 Left 1201349663 Y:13025825-13025847 CCTCCTTCCCTCTTTTCCTTCTT No data
Right 1201349668 Y:13025841-13025863 CCTTCTTTCCTTCCTTCCTCTGG No data
1201349661_1201349668 -1 Left 1201349661 Y:13025819-13025841 CCACTCCCTCCTTCCCTCTTTTC No data
Right 1201349668 Y:13025841-13025863 CCTTCTTTCCTTCCTTCCTCTGG No data
1201349657_1201349668 3 Left 1201349657 Y:13025815-13025837 CCCCCCACTCCCTCCTTCCCTCT No data
Right 1201349668 Y:13025841-13025863 CCTTCTTTCCTTCCTTCCTCTGG No data
1201349660_1201349668 0 Left 1201349660 Y:13025818-13025840 CCCACTCCCTCCTTCCCTCTTTT No data
Right 1201349668 Y:13025841-13025863 CCTTCTTTCCTTCCTTCCTCTGG No data
1201349658_1201349668 2 Left 1201349658 Y:13025816-13025838 CCCCCACTCCCTCCTTCCCTCTT No data
Right 1201349668 Y:13025841-13025863 CCTTCTTTCCTTCCTTCCTCTGG No data
1201349664_1201349668 -10 Left 1201349664 Y:13025828-13025850 CCTTCCCTCTTTTCCTTCTTTCC 0: 3
1: 75
2: 877
3: 5537
4: 18241
Right 1201349668 Y:13025841-13025863 CCTTCTTTCCTTCCTTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201349668 Original CRISPR CCTTCTTTCCTTCCTTCCTC TGG Intergenic
No off target data available for this crispr