ID: 1201349675

View in Genome Browser
Species Human (GRCh38)
Location Y:13025876-13025898
Sequence TCTATGTTGGTCTGCCTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201349667_1201349675 12 Left 1201349667 Y:13025841-13025863 CCTTCTTTCCTTCCTTCCTCTGG No data
Right 1201349675 Y:13025876-13025898 TCTATGTTGGTCTGCCTGATGGG No data
1201349671_1201349675 -4 Left 1201349671 Y:13025857-13025879 CCTCTGGAACTCCAGAGTGTCTA No data
Right 1201349675 Y:13025876-13025898 TCTATGTTGGTCTGCCTGATGGG No data
1201349663_1201349675 28 Left 1201349663 Y:13025825-13025847 CCTCCTTCCCTCTTTTCCTTCTT No data
Right 1201349675 Y:13025876-13025898 TCTATGTTGGTCTGCCTGATGGG No data
1201349670_1201349675 0 Left 1201349670 Y:13025853-13025875 CCTTCCTCTGGAACTCCAGAGTG No data
Right 1201349675 Y:13025876-13025898 TCTATGTTGGTCTGCCTGATGGG No data
1201349664_1201349675 25 Left 1201349664 Y:13025828-13025850 CCTTCCCTCTTTTCCTTCTTTCC 0: 3
1: 75
2: 877
3: 5537
4: 18241
Right 1201349675 Y:13025876-13025898 TCTATGTTGGTCTGCCTGATGGG No data
1201349662_1201349675 29 Left 1201349662 Y:13025824-13025846 CCCTCCTTCCCTCTTTTCCTTCT 0: 3
1: 51
2: 710
3: 5926
4: 25288
Right 1201349675 Y:13025876-13025898 TCTATGTTGGTCTGCCTGATGGG No data
1201349666_1201349675 20 Left 1201349666 Y:13025833-13025855 CCTCTTTTCCTTCTTTCCTTCCT 0: 5
1: 90
2: 1183
3: 8814
4: 54489
Right 1201349675 Y:13025876-13025898 TCTATGTTGGTCTGCCTGATGGG No data
1201349669_1201349675 4 Left 1201349669 Y:13025849-13025871 CCTTCCTTCCTCTGGAACTCCAG No data
Right 1201349675 Y:13025876-13025898 TCTATGTTGGTCTGCCTGATGGG No data
1201349665_1201349675 21 Left 1201349665 Y:13025832-13025854 CCCTCTTTTCCTTCTTTCCTTCC 0: 6
1: 135
2: 1238
3: 5859
4: 19025
Right 1201349675 Y:13025876-13025898 TCTATGTTGGTCTGCCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201349675 Original CRISPR TCTATGTTGGTCTGCCTGAT GGG Intergenic
No off target data available for this crispr