ID: 1201351834

View in Genome Browser
Species Human (GRCh38)
Location Y:13052486-13052508
Sequence TTCAGTAATCCCTAAAAGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201351834_1201351837 25 Left 1201351834 Y:13052486-13052508 CCGAACTTTTAGGGATTACTGAA No data
Right 1201351837 Y:13052534-13052556 TCTGAAATGACGCTAATTCCAGG No data
1201351834_1201351838 26 Left 1201351834 Y:13052486-13052508 CCGAACTTTTAGGGATTACTGAA No data
Right 1201351838 Y:13052535-13052557 CTGAAATGACGCTAATTCCAGGG No data
1201351834_1201351836 1 Left 1201351834 Y:13052486-13052508 CCGAACTTTTAGGGATTACTGAA No data
Right 1201351836 Y:13052510-13052532 TTTTAGGAATTACTGAACATTGG No data
1201351834_1201351839 27 Left 1201351834 Y:13052486-13052508 CCGAACTTTTAGGGATTACTGAA No data
Right 1201351839 Y:13052536-13052558 TGAAATGACGCTAATTCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201351834 Original CRISPR TTCAGTAATCCCTAAAAGTT CGG (reversed) Intergenic
No off target data available for this crispr