ID: 1201352281 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:13057030-13057052 |
| Sequence | TATGGTATAAAGAAGGGGAC CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1201352276_1201352281 | -1 | Left | 1201352276 | Y:13057008-13057030 | CCATCTTGACTTAATTTTTGTAT | 0: 70 1: 10865 2: 12835 3: 7618 4: 6839 |
||
| Right | 1201352281 | Y:13057030-13057052 | TATGGTATAAAGAAGGGGACCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1201352281 | Original CRISPR | TATGGTATAAAGAAGGGGAC CGG | Intergenic | ||
| No off target data available for this crispr | |||||