ID: 1201352281

View in Genome Browser
Species Human (GRCh38)
Location Y:13057030-13057052
Sequence TATGGTATAAAGAAGGGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201352276_1201352281 -1 Left 1201352276 Y:13057008-13057030 CCATCTTGACTTAATTTTTGTAT 0: 70
1: 10865
2: 12835
3: 7618
4: 6839
Right 1201352281 Y:13057030-13057052 TATGGTATAAAGAAGGGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201352281 Original CRISPR TATGGTATAAAGAAGGGGAC CGG Intergenic
No off target data available for this crispr