ID: 1201354218

View in Genome Browser
Species Human (GRCh38)
Location Y:13081301-13081323
Sequence GCAGCCTGCTTGGCTTGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201354215_1201354218 4 Left 1201354215 Y:13081274-13081296 CCAGAAACTAGGAAGGGGAGGAA No data
Right 1201354218 Y:13081301-13081323 GCAGCCTGCTTGGCTTGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201354218 Original CRISPR GCAGCCTGCTTGGCTTGAAC TGG Intergenic
No off target data available for this crispr