ID: 1201355579

View in Genome Browser
Species Human (GRCh38)
Location Y:13093918-13093940
Sequence GAAAATGCACAAATAAAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201355577_1201355579 10 Left 1201355577 Y:13093885-13093907 CCAAGTTCTTGGCATTTTGAGCA No data
Right 1201355579 Y:13093918-13093940 GAAAATGCACAAATAAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201355579 Original CRISPR GAAAATGCACAAATAAAGCA AGG Intergenic
No off target data available for this crispr