ID: 1201360168

View in Genome Browser
Species Human (GRCh38)
Location Y:13138177-13138199
Sequence GTGGTAGAATTGAGGAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201360165_1201360168 3 Left 1201360165 Y:13138151-13138173 CCAGTTAAACAAAATAGAAGAGA No data
Right 1201360168 Y:13138177-13138199 GTGGTAGAATTGAGGAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201360168 Original CRISPR GTGGTAGAATTGAGGAACAA AGG Intergenic
No off target data available for this crispr