ID: 1201361319 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:13153069-13153091 |
| Sequence | CAGTGAGAGGTGAAGGTAGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1201361319_1201361326 | 6 | Left | 1201361319 | Y:13153069-13153091 | CCAGCTACCTTCACCTCTCACTG | No data | ||
| Right | 1201361326 | Y:13153098-13153120 | CAGGGATGAGCCACTGCACCTGG | 0: 39 1: 7224 2: 33674 3: 84011 4: 145530 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1201361319 | Original CRISPR | CAGTGAGAGGTGAAGGTAGC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||