ID: 1201361319

View in Genome Browser
Species Human (GRCh38)
Location Y:13153069-13153091
Sequence CAGTGAGAGGTGAAGGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201361319_1201361326 6 Left 1201361319 Y:13153069-13153091 CCAGCTACCTTCACCTCTCACTG No data
Right 1201361326 Y:13153098-13153120 CAGGGATGAGCCACTGCACCTGG 0: 39
1: 7224
2: 33674
3: 84011
4: 145530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201361319 Original CRISPR CAGTGAGAGGTGAAGGTAGC TGG (reversed) Intergenic
No off target data available for this crispr