ID: 1201361326

View in Genome Browser
Species Human (GRCh38)
Location Y:13153098-13153120
Sequence CAGGGATGAGCCACTGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270478
Summary {0: 39, 1: 7224, 2: 33674, 3: 84011, 4: 145530}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201361325_1201361326 -7 Left 1201361325 Y:13153082-13153104 CCTCTCACTGGGATTACAGGGAT No data
Right 1201361326 Y:13153098-13153120 CAGGGATGAGCCACTGCACCTGG 0: 39
1: 7224
2: 33674
3: 84011
4: 145530
1201361318_1201361326 15 Left 1201361318 Y:13153060-13153082 CCAGGAAGTCCAGCTACCTTCAC No data
Right 1201361326 Y:13153098-13153120 CAGGGATGAGCCACTGCACCTGG 0: 39
1: 7224
2: 33674
3: 84011
4: 145530
1201361322_1201361326 -1 Left 1201361322 Y:13153076-13153098 CCTTCACCTCTCACTGGGATTAC No data
Right 1201361326 Y:13153098-13153120 CAGGGATGAGCCACTGCACCTGG 0: 39
1: 7224
2: 33674
3: 84011
4: 145530
1201361319_1201361326 6 Left 1201361319 Y:13153069-13153091 CCAGCTACCTTCACCTCTCACTG No data
Right 1201361326 Y:13153098-13153120 CAGGGATGAGCCACTGCACCTGG 0: 39
1: 7224
2: 33674
3: 84011
4: 145530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201361326 Original CRISPR CAGGGATGAGCCACTGCACC TGG Intergenic
Too many off-targets to display for this crispr