ID: 1201361929

View in Genome Browser
Species Human (GRCh38)
Location Y:13161410-13161432
Sequence CAAGTACAGCCTTCCCAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201361929_1201361932 -3 Left 1201361929 Y:13161410-13161432 CCCAACTGGGAAGGCTGTACTTG 0: 1
1: 0
2: 1
3: 4
4: 124
Right 1201361932 Y:13161430-13161452 TTGATGATGAGGAAAGCTGAAGG 0: 1
1: 0
2: 2
3: 17
4: 334
1201361929_1201361936 29 Left 1201361929 Y:13161410-13161432 CCCAACTGGGAAGGCTGTACTTG 0: 1
1: 0
2: 1
3: 4
4: 124
Right 1201361936 Y:13161462-13161484 ATTGAGACCTAGGTGGTGACTGG 0: 1
1: 0
2: 0
3: 10
4: 104
1201361929_1201361934 19 Left 1201361929 Y:13161410-13161432 CCCAACTGGGAAGGCTGTACTTG 0: 1
1: 0
2: 1
3: 4
4: 124
Right 1201361934 Y:13161452-13161474 GGTGAAGAACATTGAGACCTAGG 0: 1
1: 0
2: 0
3: 8
4: 178
1201361929_1201361935 22 Left 1201361929 Y:13161410-13161432 CCCAACTGGGAAGGCTGTACTTG 0: 1
1: 0
2: 1
3: 4
4: 124
Right 1201361935 Y:13161455-13161477 GAAGAACATTGAGACCTAGGTGG 0: 1
1: 0
2: 2
3: 14
4: 233
1201361929_1201361933 -2 Left 1201361929 Y:13161410-13161432 CCCAACTGGGAAGGCTGTACTTG 0: 1
1: 0
2: 1
3: 4
4: 124
Right 1201361933 Y:13161431-13161453 TGATGATGAGGAAAGCTGAAGGG 0: 1
1: 0
2: 1
3: 29
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201361929 Original CRISPR CAAGTACAGCCTTCCCAGTT GGG (reversed) Intergenic
900125322 1:1066652-1066674 CAAGAACATCCTTCCCTGTGAGG + Intergenic
903278364 1:22236069-22236091 CAAGTCCAGCCTTCCTTGTGGGG - Intergenic
906626132 1:47327347-47327369 CCAATACAGCCTTTCCAGTTGGG - Intergenic
908993790 1:70127570-70127592 CTGGTAGAGTCTTCCCAGTTGGG + Intronic
914293048 1:146292964-146292986 CAAGAACAGCCTTGCCAATATGG - Intergenic
914554092 1:148743747-148743769 CAAGAACAGCCTTGCCAATATGG - Intergenic
915702900 1:157812592-157812614 CAGGTACAACCTTGCCTGTTGGG + Intronic
918626847 1:186665501-186665523 CAAGAACAGCCTGGCCAGTATGG - Intergenic
921921102 1:220670544-220670566 CAAGTACAGCCTTTGCACTGGGG - Intergenic
1066638495 10:37532033-37532055 AAAGTACAGTTTTCCCTGTTTGG - Intergenic
1072894424 10:99354281-99354303 CAACTACATCCTACCCAGTTTGG - Intronic
1083317684 11:61826795-61826817 CAAGTACAACCCCACCAGTTGGG + Intronic
1085663483 11:78391723-78391745 CCATTCAAGCCTTCCCAGTTGGG + Intronic
1088261464 11:107948127-107948149 CAAGGACAGCCATGCCAGATTGG + Intronic
1089177515 11:116559257-116559279 CAAGTCCAGCCTGGCCAGTATGG + Intergenic
1089804059 11:121066994-121067016 CCACTACAGCCTTCCTAGCTCGG + Intronic
1092263622 12:6965169-6965191 CAGGGCCAGCCTTCCCAGCTTGG + Intergenic
1094212157 12:27904111-27904133 CAAGTTCTGCCATCCCACTTAGG - Intergenic
1094819556 12:34214016-34214038 CAAGTCCAGCCTGGCCAGTATGG - Intergenic
1095095167 12:38143457-38143479 CAAGTCCAGCCTGGCCAGTATGG + Intergenic
1097908426 12:64944304-64944326 CCAGGACAGCATTCACAGTTTGG - Intergenic
1098587988 12:72177238-72177260 CAAGTGGAGCCTTCCACGTTTGG - Intronic
1098897682 12:76083102-76083124 AAAGTCTAGCCTTCCCAGATGGG + Intronic
1101834021 12:108282481-108282503 CAAGTCAATCCTTCCCAGTAAGG + Intergenic
1106320680 13:28635330-28635352 AAAGTTCAGCCTTCCCATTAGGG - Intergenic
1115530296 14:34320878-34320900 GAAGTAGATCCTTCCCAGTCTGG - Intronic
1116564815 14:46431989-46432011 TAAGTACAGCCTTTCCAAATGGG + Intergenic
1117431819 14:55674066-55674088 AAAGTTCACCCTGCCCAGTTTGG + Intronic
1118082991 14:62383063-62383085 CAAATACTGCCTCCCCATTTAGG - Intergenic
1119717752 14:76870703-76870725 GAAATAAAGCCTTCCCAGTCCGG + Intergenic
1119854861 14:77891856-77891878 CAAGTACGAGCTTTCCAGTTGGG - Intronic
1126445212 15:48735532-48735554 CAAGAACAGCCTTGCCAATATGG + Intronic
1127819180 15:62640298-62640320 CAAGTACAGCCATCCAAAATTGG + Exonic
1129815466 15:78549005-78549027 AAAGTAAAGCCTTCCTAGTGTGG - Exonic
1132621899 16:871719-871741 CAAGCACAGCCTCCTCTGTTTGG - Intronic
1134882640 16:17759081-17759103 CAACTACAGCCTGCCGAGTAAGG + Intergenic
1134908287 16:18000900-18000922 CAAGAGCAGCCTCCCCAGGTTGG + Intergenic
1135518085 16:23151823-23151845 TAAGAACTGCCTTCCCAGTCTGG + Intergenic
1136632488 16:31497040-31497062 CAAGGACAGCATTCAGAGTTTGG - Intronic
1139203484 16:65003455-65003477 CAAGACCAGCCTGCCCAGTATGG - Intronic
1139901175 16:70329757-70329779 GAAGCACAGCCTTCCCAGCTGGG - Intronic
1139906024 16:70366550-70366572 GAAGCACAGCCTCCCCAGCTGGG - Intronic
1140540853 16:75755241-75755263 CAAGAACACCTTTCCCAGATAGG - Intronic
1141503912 16:84462467-84462489 CAAGTCCAGGCTCCCCAGCTGGG - Intronic
1141686694 16:85574369-85574391 CAAGAAGAGCCCTCCTAGTTTGG - Intergenic
1145967510 17:28930590-28930612 TAAGTACAGGCTTGCCAGTATGG - Intronic
1146313874 17:31792173-31792195 AAAGTACAGACTCCCCACTTCGG + Intergenic
1149538625 17:57452066-57452088 CAAATCCAGCTTTCCCAGTGTGG + Intronic
1166713777 19:44953664-44953686 CCAGGTCAGCCTGCCCAGTTGGG + Intronic
927213333 2:20651715-20651737 CAAGTGCAGCCATCCCAGGCAGG - Intergenic
931610169 2:64090479-64090501 CAAATACCACCTTCCCAGTGGGG + Intergenic
940423839 2:153509030-153509052 AAATTAAACCCTTCCCAGTTTGG + Intergenic
942573744 2:177340704-177340726 TATGTACAGCCTTCTCAGATTGG - Intronic
944325502 2:198399273-198399295 CAACTACAGCATTCACAGCTAGG - Intronic
944924642 2:204452017-204452039 CAAATACAACCTTCCCAACTGGG + Intergenic
948448313 2:238051041-238051063 CAAATACAGCCTTGCAAGTGGGG - Intronic
1168885044 20:1244095-1244117 CAATCACATCCTTCCAAGTTTGG - Exonic
1168905680 20:1401724-1401746 CAAGTACAGCCAACCAAGTGTGG + Intergenic
1169660377 20:7972494-7972516 CATGTCCAGTCCTCCCAGTTTGG - Intergenic
1170593840 20:17791003-17791025 CATGTCCTGCCTTCCCATTTGGG - Intergenic
1170968600 20:21099064-21099086 CAAGTGCCTCCTTTCCAGTTTGG + Intergenic
1171251844 20:23654804-23654826 CAAGCACATCCTTCACAGTTAGG + Intergenic
1172421031 20:34817923-34817945 CAAGTTCAAACTTCCCAGCTTGG + Intronic
1173243225 20:41316822-41316844 CTTGTTAAGCCTTCCCAGTTTGG - Intronic
1176870785 21:14082007-14082029 CAAGTCCAGCCTGGCCAGTATGG - Intergenic
1178150324 21:29786739-29786761 CCAGCCCAGCCTTCCCATTTAGG + Intronic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1181344642 22:22209933-22209955 GCAGTTCAGCCTTCCCAGCTTGG + Intergenic
1183714532 22:39525991-39526013 CAAGAACAGCCTGCCCAATATGG + Intergenic
1183954047 22:41368654-41368676 CCAGTACGTCCTTCCCCGTTCGG - Intronic
1184439268 22:44498463-44498485 CAACTACAGTCTTCCCCGATTGG - Intergenic
950457745 3:13102713-13102735 CATGTGCAGCCTTCCCTGCTTGG + Intergenic
951519735 3:23600191-23600213 CAAGGTCAGTCTTCCCAGCTGGG - Intergenic
955078478 3:55636074-55636096 CAAGACCAGCCTTGCCAGTATGG - Intronic
960040288 3:113143547-113143569 CAAGTCCTGACATCCCAGTTTGG - Intergenic
961797211 3:129418202-129418224 CATGTACATCCTGCCCACTTAGG + Intronic
967917229 3:194587778-194587800 CAAGCACAGCAATCCCATTTGGG - Exonic
968689076 4:1980897-1980919 CTAGAACAACCTTCCAAGTTAGG - Exonic
973982297 4:56316435-56316457 CAAGTAGGGCCTGCTCAGTTTGG - Exonic
983776459 4:171613520-171613542 AAAGCACAGCCTTCCAAGATAGG + Intergenic
984238061 4:177185515-177185537 AAAGTACAGCGTTCCCGTTTTGG - Intergenic
988583372 5:32488019-32488041 CAAATACAGACTTACCTGTTGGG - Intergenic
991658111 5:68923474-68923496 GAAGTATGGCCTTCCCAGATTGG + Intergenic
993049580 5:82911248-82911270 AATGTACAGCCTACTCAGTTTGG + Intergenic
997570103 5:134920864-134920886 CAAGTACAGCCTGGCCATGTTGG - Intronic
997628329 5:135346958-135346980 CAAGATCAGCCTTTCAAGTTTGG + Intronic
998598392 5:143558713-143558735 AAAGTACAGAATTCCCAGCTGGG + Intergenic
1001342504 5:170861219-170861241 CAAGTTCAGCATTTCCATTTGGG - Intergenic
1002779665 6:356773-356795 CAAGAGCCGCCTTCCCAGCTTGG + Intergenic
1003524928 6:6889667-6889689 TAAGGACAGCCTTCACACTTTGG - Intergenic
1007763404 6:44147385-44147407 GAAGTACAGCTTTCCCCGCTCGG - Exonic
1008265987 6:49426819-49426841 CAAGAACAGCCTTTACAGTAGGG - Intergenic
1010341311 6:74755917-74755939 CAAGTACATGCTTCACAGATGGG - Intergenic
1012122591 6:95386317-95386339 GAAGTACAGCCTCCCTGGTTTGG - Intergenic
1013280510 6:108632072-108632094 CAGGTTCAGCCTTCTTAGTTGGG + Intronic
1015280276 6:131426154-131426176 CAAGATCAGTCTTCCCTGTTAGG - Intergenic
1016865529 6:148762049-148762071 CAAGAACAGCCTTTTGAGTTGGG - Intronic
1017337412 6:153277890-153277912 GAAGTACATCTTTACCAGTTTGG - Intergenic
1017466838 6:154702290-154702312 CATGTAAAGACTTCCCATTTAGG - Intergenic
1018557702 6:165065604-165065626 CAAGTACTGCCTTGGTAGTTGGG - Intergenic
1019070675 6:169342256-169342278 CCAGTCCAGCCCTCCCAGCTGGG - Intergenic
1020994535 7:15246251-15246273 CAAATACAGCCTATTCAGTTTGG - Intronic
1023923937 7:44651374-44651396 CAAGTAGACTCTTACCAGTTAGG + Intronic
1024597006 7:50946889-50946911 CAATTACACCCTTCCCTGTGAGG + Intergenic
1032536553 7:132669318-132669340 CAAGTACAGCTTTGCCAGAGGGG + Intronic
1033239208 7:139663282-139663304 CCAGTCCAGCCTTCCAAGTAAGG - Intronic
1034202261 7:149289992-149290014 CAACTGCAGCCTGCCCAGTGCGG + Intronic
1040279858 8:46034612-46034634 CAAGTCCAGCCTGGCCAGTATGG - Intergenic
1040550794 8:48435914-48435936 TAAGTACAACCTTCACTGTTAGG + Intergenic
1040897269 8:52381824-52381846 CAAATACAGTGTTTCCAGTTTGG - Intronic
1041014866 8:53582979-53583001 CAAGCACAGTCTCCCCAGCTGGG + Intergenic
1042029160 8:64455758-64455780 CACCTACAGCCTTCCCACTAGGG + Intergenic
1043531033 8:81150175-81150197 CAAGAACAGCTTTCTGAGTTTGG + Intergenic
1045592954 8:103618749-103618771 CATGTACTGTCTTCCCAGCTGGG + Intronic
1047211001 8:122840291-122840313 GAAATACAGACTTCCAAGTTTGG + Intronic
1048308359 8:133299058-133299080 CAACTGCAGCATTCCCAGTGAGG + Intronic
1051820016 9:21153807-21153829 TAAGTACAGCCTGCCCATCTAGG - Intergenic
1056613570 9:88141683-88141705 CAAGTACAGTGTACACAGTTGGG + Intergenic
1059479818 9:114580435-114580457 GATGAACAGCCTTCCAAGTTGGG + Intergenic
1060020601 9:120127383-120127405 AAAGTACAGCCTTCCCAAAGAGG - Intergenic
1060108612 9:120890865-120890887 CAAGTTCAGTCTTCTTAGTTTGG + Intronic
1062181823 9:135195068-135195090 CTAGCACTGCCTTCCCAGCTGGG - Intergenic
1185475480 X:413023-413045 CAAGACCAGCCTTGCCAGTATGG + Intergenic
1186461760 X:9753798-9753820 CAGAGACAGCCTTCCCAGGTGGG - Intronic
1188456667 X:30373950-30373972 AAAGTACGAACTTCCCAGTTTGG - Intergenic
1188503447 X:30854715-30854737 CAAGTGCAACCTTCCCAGTTGGG - Exonic
1189091582 X:38089009-38089031 GAAGTCCAGCCTTCCCCATTAGG - Intronic
1194696441 X:97057490-97057512 CAAGTACAGACAGACCAGTTAGG - Intronic
1201361929 Y:13161410-13161432 CAAGTACAGCCTTCCCAGTTGGG - Intergenic
1201920282 Y:19226544-19226566 CAATTAAAGCCTACCCAGTCTGG + Intergenic