ID: 1201366628

View in Genome Browser
Species Human (GRCh38)
Location Y:13213507-13213529
Sequence CACAATAAACAGATGTAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201366628_1201366630 -8 Left 1201366628 Y:13213507-13213529 CCGGCCTACATCTGTTTATTGTG No data
Right 1201366630 Y:13213522-13213544 TTATTGTGCACAGCACCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201366628 Original CRISPR CACAATAAACAGATGTAGGC CGG (reversed) Intergenic
No off target data available for this crispr