ID: 1201370658

View in Genome Browser
Species Human (GRCh38)
Location Y:13259523-13259545
Sequence CAATGTGGCTGGAAAGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 289}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201370658 Original CRISPR CAATGTGGCTGGAAAGTAGA TGG (reversed) Intronic
901454719 1:9356461-9356483 CATTGTGGATGGACAGTACATGG + Exonic
903256002 1:22100579-22100601 CATAGTGCCTGGCAAGTAGAAGG + Intergenic
903974343 1:27139296-27139318 AAATGTGGCTGGAATGAACATGG - Intronic
903996786 1:27310361-27310383 CCATCTGGCTGGATTGTAGAGGG + Intergenic
904486097 1:30825294-30825316 CACTATGGCAGGAAATTAGATGG + Intergenic
905382346 1:37571942-37571964 CACTGTGGCTGGAATGTCGTGGG - Intronic
905721489 1:40206719-40206741 CAAGGCGGCTGGAGAGTAGTGGG - Intronic
906005323 1:42464070-42464092 CATTGTAGCAGGAAAGCAGAAGG - Intronic
906165405 1:43682297-43682319 CATTCTGGTTGGAAAGAAGATGG + Intronic
906245248 1:44268831-44268853 CTTTGTGGGTGGAAAGGAGAGGG - Intronic
906359423 1:45140139-45140161 CAATATCACTTGAAAGTAGACGG + Intronic
908789795 1:67770272-67770294 CAAGGTGGGTGGAATGGAGAGGG + Intronic
909056723 1:70829500-70829522 CCATGTGGCTGGCAAGTGTAGGG + Intergenic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
910044450 1:82894673-82894695 CAACGTAGAAGGAAAGTAGAGGG + Intergenic
910603966 1:89063045-89063067 CAAGCTGGCTGGAAAGAAAAAGG - Exonic
911572009 1:99528658-99528680 CATGGTGCCTGGAAAGTAGTAGG - Intergenic
912179046 1:107195664-107195686 CAATGTGGCTGGAAAAAGGTGGG - Intronic
912413920 1:109495412-109495434 CATTGGGGCCGGAAAGGAGAAGG + Intronic
912551306 1:110487184-110487206 GGATGTGCCTGGAAAGGAGAAGG - Intergenic
913043849 1:115056786-115056808 CACTGTGGATGCAAAGGAGAAGG - Intronic
913483051 1:119307775-119307797 CAGTATGGCTAGAAAGTAAAGGG + Intergenic
916751537 1:167727249-167727271 CAGTGTGGATGCAAAGTGGATGG - Intronic
917528362 1:175810150-175810172 GAATGTTGCAGGAATGTAGAGGG - Intergenic
920450797 1:206059761-206059783 GAATGTGGCTGGAGAGGGGATGG + Intronic
920541254 1:206779786-206779808 CAATGAGGCTGGAGTGCAGAGGG - Intergenic
921678168 1:218000536-218000558 AAATTTGGCTGGAGAGCAGAAGG - Intergenic
923570328 1:235107704-235107726 CAGTGAGGCTGGAAAGAAGTGGG + Intergenic
923638874 1:235731138-235731160 CCATGAGGTTGGATAGTAGATGG + Exonic
923660359 1:235951953-235951975 CAATGGGACTGGAAAGTCCATGG + Intergenic
1063547747 10:6998766-6998788 AGATTTGGCTGGAAAGGAGATGG + Intergenic
1064347885 10:14549040-14549062 CATTGAGGCTGGAGAGTACAGGG - Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065095744 10:22278952-22278974 CACTGTAGCTGGATAATAGAAGG - Intergenic
1066258563 10:33705975-33705997 CACTGGGGCTGGATAGTAGGAGG - Intergenic
1070371569 10:75787266-75787288 CAATGTGGAGGGAAAGCAGCAGG - Intronic
1070662925 10:78320377-78320399 AAATGTGGCTGGAAGGGAGGTGG + Intergenic
1070946408 10:80395563-80395585 CAATGTGGCTGAATAGCAGAGGG + Intergenic
1071340626 10:84643744-84643766 CAATAAGGCTGAAAAGTAGTGGG - Intergenic
1072752293 10:97990481-97990503 AAATGGGGTTGGAAAGGAGAAGG - Intronic
1075463339 10:122632962-122632984 CAATGGGGCTGGGGAGGAGATGG + Intronic
1075819070 10:125290384-125290406 CCATGTGGCTGCAAAGGACATGG - Intergenic
1076057465 10:127387216-127387238 CAGTGTGGCTGGAATGCAGAGGG - Intronic
1077327808 11:1971264-1971286 CTGTGTGGCTGGAAGGTGGAGGG - Intronic
1080198567 11:29640996-29641018 AAAAGTGGCCTGAAAGTAGAAGG + Intergenic
1080411394 11:32028629-32028651 CAGTGTGGCTGGAAACAAGGAGG - Intronic
1080948951 11:37006786-37006808 CTATGTGGTTGGAAAAGAGAAGG + Intergenic
1081934462 11:46895382-46895404 CACTAGGCCTGGAAAGTAGATGG - Intronic
1082107850 11:48240076-48240098 CCATGTGGCTGCAAAGGACAGGG + Intergenic
1082771552 11:57211491-57211513 GAATGTGGCTGTCAAGTAGCAGG + Intergenic
1083171639 11:60926940-60926962 CAAGGTCTGTGGAAAGTAGAAGG + Intronic
1084325913 11:68399955-68399977 CGATCTGGGTGGAAAGTAGGGGG + Intronic
1084770056 11:71336814-71336836 CAGGGAGGCTGGAAAGCAGAAGG - Intergenic
1086287853 11:85270333-85270355 CAATCATGGTGGAAAGTAGAAGG - Intronic
1086964805 11:93016803-93016825 CAATGTGGCAGAAAAGCAGAAGG + Intergenic
1087144245 11:94796492-94796514 CAATATGGATTGAAAGGAGAAGG + Intronic
1087268076 11:96082745-96082767 CAAGGTAGCTGGAAAGAAGGAGG + Intronic
1088506825 11:110535245-110535267 CAATTTGGATGGAGAGTAGAAGG + Intergenic
1089386254 11:118070150-118070172 GAATCTGGCTAGAAAGTAAATGG - Intergenic
1089869615 11:121660490-121660512 CTATGTGACTGGAAGGTAGTAGG + Intergenic
1202810788 11_KI270721v1_random:26444-26466 CTGTGTGGCTGGAAGGTGGAGGG - Intergenic
1091574647 12:1721878-1721900 CAGTGTGGCTGGAATGTAATGGG + Intronic
1094047108 12:26179263-26179285 TAGTGTGGCTGGACAGGAGAAGG + Intronic
1094339332 12:29393212-29393234 CAATGTAGGTTAAAAGTAGAGGG + Intergenic
1094866323 12:34535595-34535617 AAATGTGGATAAAAAGTAGAAGG - Intergenic
1095128077 12:38505859-38505881 TAATGAAGCTGGAAAGCAGAGGG - Intergenic
1096448550 12:51717262-51717284 CAATGTGGCTGGCCAGAAGATGG - Intronic
1098130453 12:67344794-67344816 CATTGTGGGTGGAAATTATATGG + Intergenic
1099997938 12:89799562-89799584 TAATGTGGCTGTGAAGTAGCAGG + Intergenic
1100358446 12:93854264-93854286 TCATGTGTCTGGAAAGTAGTAGG + Intronic
1102311097 12:111844887-111844909 CAAGGTGGCTGGAATGCAGTGGG + Intronic
1103657324 12:122483319-122483341 CAATGTGGCTGAAGACTTGATGG + Exonic
1104151084 12:126083994-126084016 CTCAGTGGCTGTAAAGTAGATGG + Intergenic
1105892363 13:24690707-24690729 CAACGTGTCTGGAAGGTAAAAGG + Exonic
1106045134 13:26132099-26132121 AAATATGGCTGGAAAGTGTATGG - Intronic
1107004290 13:35590186-35590208 CATTGTGGCTTGAAGGTAAAAGG + Intronic
1107213962 13:37893395-37893417 CAATGTAGATGGCAAGTTGATGG - Intergenic
1107252525 13:38381065-38381087 GAATGAGGCTGGAGAGTAGGTGG + Intergenic
1108367424 13:49729964-49729986 CAATCTGGCTCCAAAGTATATGG + Intronic
1108536059 13:51380534-51380556 CACAGTGCCTGGCAAGTAGAAGG - Intronic
1109135905 13:58650288-58650310 CATTGTTGAAGGAAAGTAGAAGG + Intergenic
1109288853 13:60447926-60447948 CAAGGTGGTTGGAAAATACATGG - Intronic
1109664882 13:65521173-65521195 CAAAGTCGCTGGAAATTAAAAGG + Intergenic
1110443248 13:75548927-75548949 CACTGTGGCTGCAGAGTAAAGGG - Intronic
1111451230 13:88420473-88420495 CAATGTGAATGGAAAATATATGG + Intergenic
1114779626 14:25523563-25523585 CCATGTGGCTAGAAATGAGAGGG - Intergenic
1118037056 14:61879134-61879156 CAATGTGCCTGTAAGGAAGAGGG + Intergenic
1118386528 14:65260071-65260093 ATCTGTGGCTGGAAAGGAGAGGG - Intergenic
1118448278 14:65871598-65871620 TAATGGGGCTTGAGAGTAGAAGG + Intergenic
1118570040 14:67185311-67185333 CAATGTGGCTGGGAAAGAAAAGG + Intergenic
1118675792 14:68183397-68183419 CAGTGTGGCTAGAAAGAAGCAGG - Intronic
1118866836 14:69711051-69711073 TAAGGTGGCTGGAGAGTACAGGG - Exonic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1119942479 14:78656278-78656300 CAATGTGGCTGCTGAGGAGAAGG + Intronic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1121083576 14:91127944-91127966 CAATGAGGCTGGAAATTGGTAGG - Intronic
1121467794 14:94127266-94127288 AAATGTGGCTGGAAAATTGAAGG - Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122315656 14:100824842-100824864 CAAGGTGACTGTAAAGCAGACGG - Intergenic
1122366225 14:101196290-101196312 CAAGGTGGCAGAAAAGGAGAGGG + Intergenic
1122745786 14:103896568-103896590 CCATGTGGCTGGAAGGAAGGCGG - Intergenic
1126750021 15:51867096-51867118 CAGTGTGACTGGAATGGAGAGGG + Intronic
1127505205 15:59591318-59591340 CATTTTGGTTGGAAAGTACAAGG + Intergenic
1127784022 15:62340316-62340338 GAATGTGGGTTGAAAGCAGAGGG - Intergenic
1130585285 15:85175862-85175884 CAAAGAAGCTGGAAAGTACAGGG + Intergenic
1131185740 15:90272490-90272512 AAATGTGGCTGGAGATTATAAGG - Exonic
1132249287 15:100322257-100322279 CAAGGTGACTGGAAAGTATGGGG + Intronic
1132265790 15:100469586-100469608 CAATCTGGGTGGAAAGTAGGGGG + Intronic
1133153478 16:3854638-3854660 TGTTGTGGCTGGAAAGTAGGGGG - Intronic
1134059309 16:11189332-11189354 GGATGTGGCTGGCAAGAAGATGG + Intergenic
1135470738 16:22728139-22728161 CAATGTGGCTGGCAAGGAGTGGG + Intergenic
1135506290 16:23039735-23039757 ACTTCTGGCTGGAAAGTAGATGG - Intergenic
1135621815 16:23962351-23962373 CAATGGGGCTGGAAATTAGGTGG - Intronic
1135648822 16:24187629-24187651 CCTTGTGCCTAGAAAGTAGAAGG - Intronic
1136475529 16:30510862-30510884 CAACCTGGCAGGAAAGGAGAGGG - Exonic
1137299458 16:47133720-47133742 CAGTGTGGTTGGCAAGTGGAAGG + Intronic
1139344790 16:66295998-66296020 CAATGAGGGTGGACAGTACAGGG + Intergenic
1140719091 16:77754359-77754381 TAATTTGGCTGAAAACTAGATGG + Intergenic
1140999947 16:80298730-80298752 AAATGAGGCTGGAAAGCAGCTGG - Intergenic
1141917144 16:87106841-87106863 TATGGTGGCTGGAGAGTAGAGGG + Intronic
1142474072 17:179732-179754 CAAGCTGGCAGGAAAGTGGAGGG + Intronic
1143254713 17:5547314-5547336 CAAGGTGGCTGCAAAGTCAAAGG - Intronic
1146990780 17:37270082-37270104 CAACTTGGCTGCAAAGCAGAGGG + Intronic
1147128933 17:38394471-38394493 CAGGGAGGCTGGTAAGTAGAAGG - Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1150444368 17:65217175-65217197 CAGGGTGGCTGGGAAGTGGAAGG - Intronic
1151105574 17:71612705-71612727 CCATGTTGCTGGAAAGGACATGG - Intergenic
1151310996 17:73292286-73292308 CAATGTGGCCGAATAGCAGAGGG + Intronic
1151589157 17:75032183-75032205 CAATTTGGCTGGAACCCAGAGGG + Intergenic
1152180262 17:78815526-78815548 CAATGTTCCTGTAAAGTGGAGGG - Intronic
1155545237 18:26907712-26907734 CCATGTGGCTGGATAATAGTGGG + Exonic
1155820438 18:30368954-30368976 CACTGTGACTGGAAGATAGAGGG - Intergenic
1156722179 18:40083723-40083745 CAATGAGACTGAAAAGTACAAGG - Intergenic
1156808111 18:41211848-41211870 AAGTGTGGCTGGAAGGAAGAAGG + Intergenic
1157674123 18:49555853-49555875 CAGTGTGGCAGGAAGGCAGAGGG + Intergenic
1158419590 18:57280967-57280989 CAAAGGGTCTGGAAAGTACAAGG - Intergenic
1159791278 18:72782154-72782176 CCATGTTGCTGCAAAGTACATGG + Intronic
1160376069 18:78413555-78413577 CAATATGGCTGAAAAGTATCTGG - Intergenic
1161821246 19:6532182-6532204 CAAGGGGGCTGGAAAGAAGAGGG + Intronic
1162439203 19:10682352-10682374 CACTGTGGCTGGCAGGCAGAGGG + Intronic
1162659941 19:12161101-12161123 CAATGTGGGTGAAAAGCAGGTGG + Intergenic
1164824347 19:31273510-31273532 CCATGTGGCTTGAAGGGAGATGG - Intergenic
1164937669 19:32227799-32227821 CCGTGTGGCTGAAAAGGAGAAGG + Intergenic
1165850033 19:38844542-38844564 CAAAGTGGCTGGCAAGCAGACGG - Intronic
1166549652 19:43656797-43656819 CCATGGGGCTGGAAAGGAGGGGG - Intronic
1166686363 19:44798872-44798894 CAATGTTGCCGGAAAGGAGGTGG - Intronic
1167213980 19:48151727-48151749 CAATGTGCCTGTAAAGCAGTGGG + Intronic
927474150 2:23399740-23399762 GAAAGTGGTTGGAAAGAAGATGG - Intronic
927813524 2:26194170-26194192 CATTCTGGCAGGAAAGGAGAGGG - Intronic
930226333 2:48797942-48797964 CAGTGTGGCTGGAACTTCGAAGG + Intergenic
930889035 2:56361666-56361688 CAATGTGGCTGGAACAGAGTGGG + Intronic
931226860 2:60339321-60339343 CAGTGTGGCTGGAATGGTGAGGG - Intergenic
932168726 2:69533764-69533786 CTATGTGGCTGGAAATTCCAAGG - Intronic
932470420 2:71951439-71951461 CAAGGGGGCTGGAAAGTATAAGG - Intergenic
935388949 2:102530443-102530465 TAAGTTGGCTGGAAAGCAGAAGG - Intronic
935409975 2:102751406-102751428 AAATGTGGTTGGAAAGGAGAAGG + Intronic
935666049 2:105513606-105513628 CAATGTGCCTGGAAAGGTTAAGG + Intergenic
936532606 2:113287174-113287196 TAATGTGGCTGGAGTGTAGAGGG + Intergenic
937894384 2:126967477-126967499 CCATGTAGCAGGAAACTAGAGGG + Intergenic
938243183 2:129758752-129758774 TAATGTTGCTGGAAAGTCGCTGG - Intergenic
938337696 2:130513773-130513795 CATTCTGGCTGGAAAGAAGAAGG - Intergenic
938342385 2:130544249-130544271 CAATGTGGCTGCAAGGGAGCAGG + Intronic
938347447 2:130576460-130576482 CAATGTGGCTGCAAGGGAGCAGG - Intronic
938352143 2:130606962-130606984 CATTCTGGCTGGAAAGAAGAAGG + Intergenic
939072927 2:137565380-137565402 TAACATGGTTGGAAAGTAGAAGG + Intronic
939474822 2:142673944-142673966 CGATGTGGTTGGAAAGGAAAAGG - Intergenic
939495921 2:142928550-142928572 CAACGTGGCTGGAAGGGAAATGG + Intronic
941773346 2:169365353-169365375 CAATGGGGGTGGAAAAAAGAAGG - Intergenic
942286993 2:174429282-174429304 CAAGGTGGCAGCAAAGGAGAAGG - Exonic
943065932 2:183086124-183086146 CAATCTGGCTGAAAAGTAAGGGG - Intronic
944162048 2:196673169-196673191 AATTGTGCCTGGAATGTAGAAGG - Intronic
944246242 2:197533190-197533212 AAATGTGGCAGGAAATTGGATGG + Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
1168857554 20:1019522-1019544 AAATGTGGTTGGATGGTAGATGG - Intergenic
1169005526 20:2204144-2204166 CAGTGTGGCTGGAATGAAGTGGG - Intergenic
1169275336 20:4229970-4229992 CAATGTGGCTGGAACAGAGTAGG - Intronic
1170192329 20:13656525-13656547 CAATGAATCTGGAAAGCAGATGG - Intergenic
1170255260 20:14335475-14335497 AAATGTGGCAGCAAAATAGAAGG - Intronic
1172041045 20:32046156-32046178 CATTGTGGCTGGAACACAGAGGG - Intergenic
1173375569 20:42479543-42479565 CGATGATGCTGGAAAGAAGATGG - Intronic
1173896839 20:46557578-46557600 CAATGTGGGAGGAAGGGAGAAGG - Intergenic
1174779236 20:53372951-53372973 GAATGTGGCTGGAAAGGTAAGGG - Intronic
1175003072 20:55651073-55651095 CAGTATAGCTGGAAAGTAGAAGG - Intergenic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1177027891 21:15943937-15943959 AAATTTGGCTGGAAATTAAATGG + Intergenic
1179363608 21:40735551-40735573 CAGTGTGTCTGGAATGTAGGTGG - Intronic
1180897919 22:19350767-19350789 CACTGTGGCTGGCACATAGAAGG - Intronic
1181751938 22:24994952-24994974 GAACGTGGCTGGAAAGCAGGAGG - Intronic
1181861421 22:25822135-25822157 CAGTGTGGCTGGAATGTAACGGG - Intronic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
949779328 3:7668354-7668376 CACTGTGGGTGGCAAATAGAGGG - Intronic
950110356 3:10414724-10414746 CGATGTGGCTGGAAGGGTGAGGG + Intronic
950171978 3:10844979-10845001 CACAGGGGCTGGGAAGTAGAGGG + Intronic
950932708 3:16806542-16806564 TCATGTGGCTGGAAAGTAGCAGG + Intronic
951303935 3:21034613-21034635 CCATGTTGCTGGAAAGGATATGG + Intergenic
952742603 3:36748762-36748784 CAAAATGACTGGAAAGCAGAAGG - Intergenic
955292786 3:57707846-57707868 TAATGGGTATGGAAAGTAGATGG + Intergenic
955390303 3:58517690-58517712 CAAGTAGGTTGGAAAGTAGAAGG + Intronic
957555077 3:81756613-81756635 CAAGGTGGCAGAAAAGAAGAGGG + Intronic
957774006 3:84732049-84732071 CAATGTGACTGGATCATAGAGGG + Intergenic
957800536 3:85074152-85074174 TAATGTGGCTGGAGAGAAGTGGG - Intronic
958531567 3:95339424-95339446 AAATGTGGTTGAAAAATAGATGG - Intergenic
958803802 3:98785571-98785593 CAGTGAAGCTGGAAAGTAGCAGG + Intronic
958892737 3:99798410-99798432 CAATGTGGCTGTTTAGCAGAAGG - Exonic
959309074 3:104708226-104708248 GAATAGGGTTGGAAAGTAGAGGG + Intergenic
959545136 3:107587219-107587241 CAAAGTAGCTGCAAAGTAGCTGG - Intronic
960103044 3:113765194-113765216 CAATGTGACTACAAAGTAAATGG - Intronic
960785336 3:121367462-121367484 AACTTTGGATGGAAAGTAGAAGG - Intronic
962101944 3:132351885-132351907 CAGAGTGGCTGGAAGGTATAGGG - Intronic
964897344 3:161613810-161613832 CAATCTTGGTGGAAGGTAGAAGG - Intergenic
966116378 3:176468265-176468287 CAATGTGGCTAGAACAAAGAAGG + Intergenic
967828174 3:193895453-193895475 CCATGGGGCTGGATCGTAGAAGG - Intergenic
967934211 3:194713710-194713732 CAAAGTGGCTGAAAAGAAAATGG + Intergenic
969492448 4:7507592-7507614 CCAAGTGGCACGAAAGTAGACGG + Intronic
970159630 4:13175797-13175819 CCATGTGGCTTGGAGGTAGATGG - Intergenic
970218674 4:13785277-13785299 TCATTTGGCTGGAATGTAGATGG + Intergenic
973168075 4:47102669-47102691 CAATGTGGCTGGAACATAAAGGG + Intronic
973764675 4:54152299-54152321 CTATGTTTGTGGAAAGTAGATGG + Intronic
974124723 4:57681974-57681996 CGATGTGTCTGGAACGTTGAAGG - Intergenic
976500680 4:85785182-85785204 CACTGTGGCTGGCACATAGAAGG - Intronic
979064263 4:116108107-116108129 CAATGTTGCTGCAAAGAACATGG + Intergenic
980675387 4:136072268-136072290 CAATGTAGCTAGAAAACAGAGGG - Intergenic
980995304 4:139774383-139774405 CACTGTGGCTGGCACGTAGTAGG + Intronic
981322700 4:143411091-143411113 CAATGTGGTTGGAAGGCAGAGGG + Intronic
981457647 4:144973193-144973215 CCATGTTGCTGAAAAGTACATGG - Intronic
982020569 4:151199612-151199634 CAGTGTGGCAGGAAAGAAGAGGG - Intronic
982469796 4:155774248-155774270 CAATGTGGCTGGAACAGAGGAGG - Intronic
982545816 4:156731770-156731792 CACTGTGGCTGGAAGGGAGAAGG - Intergenic
984095198 4:175425787-175425809 AAAAGAGGCTGGAAAGCAGAGGG - Intergenic
984878470 4:184390164-184390186 GAAAGTGGCTGGAATGGAGATGG - Intronic
985863600 5:2494112-2494134 CAATGTGGGTGAAAAGTCCATGG + Intergenic
986656569 5:10018737-10018759 CAAATTGGCTTGAAAGTTGAGGG - Intergenic
986866336 5:11993304-11993326 AAATGTGTCTGGAAAATAGAGGG + Intergenic
987392025 5:17385628-17385650 TAATGTGGCTGAAAAATATATGG - Intergenic
987790398 5:22558831-22558853 CAATGTGCTTTGAAAGAAGAAGG + Intronic
987972816 5:24971938-24971960 CTATGTGCCTTGAATGTAGAAGG + Intergenic
988197440 5:28023362-28023384 CAATCTGGCTGGTGACTAGAAGG - Intergenic
989404309 5:41043183-41043205 CAATCTGGCTTGAAATGAGAGGG + Intronic
990262812 5:54043466-54043488 AAATGTTGCTGGAAAATATAAGG - Intronic
990635783 5:57724716-57724738 TAATGTGGATGGAAACCAGAGGG - Intergenic
991530951 5:67613556-67613578 CCATGTCTCTGGAGAGTAGATGG - Intergenic
992161406 5:74007287-74007309 CATCTTGGCTGGAAAGCAGAAGG + Intergenic
992735674 5:79717717-79717739 CATTGTGGATGGAAAGAATAAGG - Intronic
993863115 5:93159786-93159808 CAATGGAGCTGGCATGTAGAGGG + Intergenic
994472739 5:100229597-100229619 AAATGTGGCAAGAAAGAAGAAGG - Intergenic
997221433 5:132169422-132169444 CAAGGTTGCTAGAAAATAGAAGG - Intergenic
997358702 5:133280769-133280791 CAGCGTGGCTGGAATGTGGAGGG - Intronic
997906564 5:137822994-137823016 GGCTGGGGCTGGAAAGTAGAGGG - Intergenic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998718878 5:144919229-144919251 CCATTGGGCTGGAAGGTAGATGG + Intergenic
999884534 5:155906402-155906424 CAATGAGGAAGGCAAGTAGAAGG + Intronic
999955774 5:156700019-156700041 CAATCTGGTTGGAATGTGGAGGG + Intronic
1000991919 5:167920036-167920058 CCATCTGGCAGGAAAGGAGATGG + Intronic
1005172975 6:23009417-23009439 CAATATGGCTTGAAAGCAGATGG + Intergenic
1005509803 6:26501927-26501949 GAAGGTGGCTGGTGAGTAGACGG + Exonic
1005727383 6:28663212-28663234 AAATGTCGCTGGAAAAAAGAAGG + Intergenic
1006211163 6:32396201-32396223 CCATGTGGCTGGAGAGCAGATGG - Exonic
1006379916 6:33691480-33691502 CACTGTGGCTGGACAGTGGAGGG + Intronic
1006929388 6:37678592-37678614 CAATGTGGCTGGAGTGGGGAGGG - Intronic
1008216884 6:48802858-48802880 CAAAGTGGATGCAAAGTGGATGG + Intergenic
1008779383 6:55084390-55084412 CCATGTGGCTGCAAAGAACATGG - Intergenic
1008929387 6:56922363-56922385 CAATGTGGTTGGAATGTAACTGG + Intronic
1009397971 6:63223648-63223670 CAATGTGGCAGGAAGGTATAGGG + Intergenic
1010410726 6:75558575-75558597 CATTTTGGCTGAAAAGCAGATGG + Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011380826 6:86740518-86740540 CAATGTGGCTGGAACAAAGCAGG - Intergenic
1014958246 6:127648809-127648831 CCATGTTGCTGGAAATTATAGGG - Intergenic
1015804760 6:137097651-137097673 AAATGTGGCTGGGAAGAACATGG + Intergenic
1016389703 6:143562327-143562349 CAATGAGGCTGGAAAGCAAAGGG + Intronic
1016520088 6:144937315-144937337 CAATGTGTCTGTCAATTAGAAGG - Intergenic
1017628833 6:156375989-156376011 TAATATGGATGAAAAGTAGATGG - Intergenic
1017753993 6:157514312-157514334 CAATGTTCCTGAAGAGTAGATGG - Intronic
1018254908 6:161908367-161908389 CAATCTGGCAGGAGAGGAGAAGG - Intronic
1020363382 7:7353844-7353866 TATTGTTGTTGGAAAGTAGAAGG - Intergenic
1020657172 7:10941256-10941278 TAGTGTGGCTGGAAAGTAAAAGG + Intergenic
1023311628 7:38893198-38893220 CAATGTGGCTGTAGTGTAGAAGG - Intronic
1026135009 7:67652265-67652287 CATTGAGGCTGAAAACTAGAAGG + Intergenic
1026214303 7:68334669-68334691 CAAAGTGCCTGGAAACCAGAGGG + Intergenic
1026221458 7:68401464-68401486 CAAGGTGGCTGGGGAGTTGAAGG + Intergenic
1027428923 7:78089796-78089818 CCATATGGATGGAAAGAAGAGGG - Intronic
1027700231 7:81460483-81460505 CAATGTGGCTAGAATTTACAGGG + Intergenic
1028163403 7:87510838-87510860 AAATGAAGGTGGAAAGTAGAGGG + Intronic
1030576986 7:111300454-111300476 CAATGTGGCTAGAGAGTACATGG - Intronic
1032614782 7:133456270-133456292 CCATGTGGCTGGAAAATATTTGG + Intronic
1034765137 7:153713366-153713388 CCATGTGGCTGCAAAGGACATGG - Intergenic
1036685555 8:10907415-10907437 CAAGGTGGCTGTTCAGTAGAGGG - Intronic
1036984739 8:13515956-13515978 GAATGTGGAAGGAAAGAAGAGGG + Intergenic
1037635905 8:20700888-20700910 CCATGTGGCTGGGAAGCAGTTGG + Intergenic
1041065323 8:54077177-54077199 CCATGTTGCTGCAAAGTACATGG - Intronic
1041083146 8:54232576-54232598 AATTCTGCCTGGAAAGTAGAAGG - Intergenic
1042046734 8:64661606-64661628 AAATTTGTGTGGAAAGTAGAGGG + Intronic
1042130775 8:65585120-65585142 CAATGTGGCTGGGATGCAGAGGG - Intergenic
1042313063 8:67397599-67397621 CAATGTGGGTTGAAGGGAGAGGG - Intergenic
1044808473 8:96032847-96032869 AAAAGTGACTGAAAAGTAGAGGG + Intergenic
1045863622 8:106840256-106840278 CAATGAGGATGGAGAGAAGATGG - Intergenic
1046565869 8:115900398-115900420 CAACGTGGTTGGAAAATAGAAGG - Intergenic
1048934373 8:139342891-139342913 CAAGGTGTCTTGAAAATAGAAGG + Intergenic
1050626245 9:7506945-7506967 CAAGGTGTCTGGAAAGTAATAGG + Intergenic
1050782393 9:9354062-9354084 CAATGTGGCTTCATAGAAGAAGG - Intronic
1050803134 9:9640720-9640742 TTATGAGGCTGGGAAGTAGAGGG + Intronic
1051749389 9:20325543-20325565 CAACGTGGCTGGAAAGAACTCGG + Intergenic
1051931374 9:22390167-22390189 GAATCTAGCTGAAAAGTAGAAGG + Intergenic
1055024877 9:71708970-71708992 AAATGTGGTTGGAACGTAGTTGG - Intronic
1059155347 9:111984216-111984238 CAATGTGGCAGGAATGTACAAGG - Intergenic
1061185032 9:129048123-129048145 CAAGGAGGCGGGAAAGCAGATGG + Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1186545986 X:10449902-10449924 GAAAGTGGGTGGAAAGTAGTGGG + Intronic
1187552628 X:20321539-20321561 CAATGTTGTTGCAAAGGAGACGG + Intergenic
1188970788 X:36613095-36613117 CAATGAGACTGGATAGAAGAGGG + Intergenic
1190022727 X:46894008-46894030 CAATGTGGTTGGAATGTATGTGG - Intronic
1194014677 X:88604762-88604784 CCATGTGGCAAGATAGTAGAAGG - Intergenic
1194470744 X:94292551-94292573 TAATGGGACTGGAAAGAAGAGGG - Intergenic
1195960242 X:110378636-110378658 CACTGATGCTGGAAAGTATAGGG - Intronic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1198040674 X:132848489-132848511 CTAAGTGCCAGGAAAGTAGAAGG - Intronic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1198594916 X:138225777-138225799 CAATTTGCCTGGAAAGAGGAGGG + Intergenic
1198799415 X:140433620-140433642 TAATGTGGTTTAAAAGTAGAGGG - Intergenic
1199523114 X:148759927-148759949 CAATGTGCCTAAAAAGTTGATGG - Intronic
1199850132 X:151720275-151720297 CATTGTGGATGGGAAGCAGATGG - Intronic
1199940802 X:152625860-152625882 CAGTGTGACTAGAAAGTAAAGGG + Intergenic
1200015415 X:153158767-153158789 CAATGGTGCTGGAAGATAGATGG - Intergenic
1200298869 X:154952161-154952183 CCATGAGGCTGGAGAGAAGAGGG + Intronic
1201310963 Y:12597877-12597899 CAGGGTGGCTGGAAAGAGGAGGG + Intergenic
1201370658 Y:13259523-13259545 CAATGTGGCTGGAAAGTAGATGG - Intronic