ID: 1201374753

View in Genome Browser
Species Human (GRCh38)
Location Y:13306810-13306832
Sequence CATCGGAGGGAGACTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 908
Summary {0: 1, 1: 0, 2: 5, 3: 103, 4: 799}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201374753 Original CRISPR CATCGGAGGGAGACTGAGGC AGG (reversed) Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901517758 1:9760773-9760795 GCTCTGAGGGAGGCTGAGGCAGG - Intronic
901776128 1:11561445-11561467 AATCGGAGGGACACAGAGGTTGG - Intergenic
901974034 1:12930252-12930274 CATGGGAGGGAGGCTGAGAGGGG + Intronic
902007256 1:13242324-13242346 GATAGTAGGGAGGCTGAGGCAGG - Intergenic
902011146 1:13271516-13271538 CATGGGAGGGAGGCTGAGAGGGG - Intergenic
902026307 1:13386633-13386655 GATAGTAGGGAGGCTGAGGCAGG - Intergenic
902094518 1:13931947-13931969 CTTGGGAGGGAGGTTGAGGCAGG - Intergenic
902585419 1:17436255-17436277 CTTTGGAAGGAGGCTGAGGCAGG + Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903498690 1:23790012-23790034 ACTCGGGGGGAGGCTGAGGCAGG - Intergenic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904409240 1:30314970-30314992 GATTGGAGGGAACCTGAGGCAGG + Intergenic
904591265 1:31616827-31616849 CAGGGGAGGGAGACTGTGTCTGG + Intergenic
904721634 1:32514301-32514323 AATCCCAGGGAGACTGAGGTAGG + Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905491116 1:38344544-38344566 CATAGGAGGGAGGCTGAAGTAGG + Intergenic
905559687 1:38916599-38916621 CTTTGGCGGGAGGCTGAGGCAGG + Intronic
905787211 1:40767731-40767753 TTTGGGAGGGAGGCTGAGGCAGG + Intronic
906308113 1:44734153-44734175 CTCAGGAGGGAGGCTGAGGCAGG - Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906646769 1:47480919-47480941 CATCCCAGGGAGAGAGAGGCTGG - Intergenic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
906813245 1:48850761-48850783 AATGGGTGGGAGGCTGAGGCGGG - Intronic
907010070 1:50954650-50954672 CAGCTGTGGGAGGCTGAGGCAGG - Intronic
908125529 1:61026471-61026493 CAACACTGGGAGACTGAGGCGGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908831217 1:68180429-68180451 GTTGGGAGGGAAACTGAGGCAGG + Intronic
908983485 1:69987131-69987153 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
909019704 1:70417394-70417416 GCTACGAGGGAGACTGAGGCAGG - Intronic
909616570 1:77616753-77616775 CCCAGGAGGGAGACTGAAGCAGG + Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
909681859 1:78300493-78300515 ACTCGGGGGGAGGCTGAGGCAGG + Intergenic
910602185 1:89043701-89043723 CACCAGAGGGAGGCTGAGGCCGG - Intergenic
910831821 1:91469068-91469090 CATGGGAGAAAGACAGAGGCTGG + Intergenic
911025908 1:93435277-93435299 CATGGGAGGGAGGCTGAGAGGGG - Intergenic
911317125 1:96369183-96369205 CAGCACTGGGAGACTGAGGCAGG + Intergenic
911419366 1:97620324-97620346 CTTAGGAGGGAGGCTGAGGCTGG - Intronic
911728807 1:101270127-101270149 AGTCTGAGGGAGTCTGAGGCAGG - Intergenic
911960163 1:104291796-104291818 CTCAGGAGGGAGGCTGAGGCAGG - Intergenic
912013791 1:105005796-105005818 CATGGGAGGGAGCCTCAGGTGGG - Intergenic
912527629 1:110295817-110295839 CATTAGTGGGAGGCTGAGGCAGG - Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913064757 1:115240377-115240399 ACTCGGAAGGAGACTGATGCAGG + Intergenic
913291840 1:117280744-117280766 TTTCAGAGGGAGGCTGAGGCAGG + Intergenic
913459613 1:119070371-119070393 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
914679887 1:149931698-149931720 CAGCGGATGGAGACTGGGGTTGG - Intronic
914733888 1:150397856-150397878 CTCCGGAGGCTGACTGAGGCAGG - Intronic
914767028 1:150647380-150647402 CTTAGTTGGGAGACTGAGGCAGG + Exonic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915388321 1:155517519-155517541 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
915562198 1:156693865-156693887 CATCTTAGGGAAACTGAGGCAGG - Intergenic
916135483 1:161649568-161649590 GAACGGAGCAAGACTGAGGCAGG + Intronic
916526137 1:165611363-165611385 CCCGGGAGGGAGGCTGAGGCAGG - Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917390707 1:174533120-174533142 CCTAGTCGGGAGACTGAGGCAGG + Intronic
917626376 1:176850678-176850700 CCTGGGAGGGAGAATGAGCCAGG + Intergenic
917683167 1:177388451-177388473 TATCAAAGGGACACTGAGGCTGG - Intergenic
918016375 1:180636938-180636960 CCTACGCGGGAGACTGAGGCAGG + Intronic
918500286 1:185187304-185187326 AAGCCGAGGGAGGCTGAGGCAGG - Intronic
918851353 1:189694494-189694516 CATCGAGGGGAGGCTGAGGCAGG - Intergenic
919098685 1:193067295-193067317 CTCAGGAGGGAGGCTGAGGCAGG - Intronic
919253841 1:195096366-195096388 CATGGGAGGGAGCCTGAAGGGGG + Intergenic
920184225 1:204150635-204150657 CTACGTAGGGAAACTGAGGCAGG + Intronic
921031786 1:211340587-211340609 GTTGGGAGGGAAACTGAGGCAGG + Intronic
921754354 1:218836794-218836816 CTCGGGAGGGAGGCTGAGGCAGG - Intergenic
922037567 1:221863982-221864004 CCTAGGAGGGAGAGTGAGTCAGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922983924 1:229851406-229851428 CCTGGGAGGGAGACAGGGGCTGG - Intergenic
923445011 1:234062789-234062811 CTACTCAGGGAGACTGAGGCAGG - Intronic
923598648 1:235381571-235381593 CTACTAAGGGAGACTGAGGCAGG + Intronic
924152114 1:241140126-241140148 CTTCGGATGGAGACACAGGCAGG + Intronic
924275760 1:242385277-242385299 GTTGGGAGGGAAACTGAGGCAGG + Intronic
924298640 1:242614289-242614311 CTCTGGAGGGAGACTGAGGCTGG - Intergenic
1062993311 10:1841039-1841061 CCTACTAGGGAGACTGAGGCAGG + Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063192996 10:3715711-3715733 CTCAGGAGGGAGGCTGAGGCAGG - Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064325037 10:14341898-14341920 CAGCACTGGGAGACTGAGGCAGG - Intronic
1064435191 10:15304978-15305000 CTTTGGAAGGAGGCTGAGGCAGG - Intronic
1064589205 10:16871286-16871308 CAGCACAGGGAGGCTGAGGCAGG - Intronic
1065794970 10:29298380-29298402 CAGAGGAGGGACACTGAGGTTGG - Intronic
1065976515 10:30847005-30847027 CATGGAAGGGAGGCTGAGGAAGG + Intronic
1066456037 10:35573200-35573222 CGTCCCAGGGAGGCTGAGGCGGG - Intergenic
1066572970 10:36793222-36793244 AATCCCAGGGAGACTGAGGCAGG - Intergenic
1067533654 10:47092612-47092634 CATCAGAGGGCCACTGAGGGAGG - Intergenic
1068283726 10:54909369-54909391 CCTGGGAGGGAGGCTGAGACAGG - Intronic
1068605983 10:59005517-59005539 CTTTGGAAGGAGACTGAGGCTGG - Intergenic
1068842377 10:61629955-61629977 GCTGGGAGGGAGACTGAGGCCGG + Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069241069 10:66139801-66139823 CATCTCAGGATGACTGAGGCTGG - Intronic
1069561824 10:69436051-69436073 CCTGGGAGGGAGGCTGAGGTGGG - Intergenic
1069684847 10:70311338-70311360 AATCCCAGGGAGGCTGAGGCAGG - Intronic
1070275129 10:74998670-74998692 AATCTTTGGGAGACTGAGGCAGG + Intronic
1071440863 10:85692553-85692575 CACAGGAGGGAGGCTGAGGTGGG + Intronic
1071533224 10:86404976-86404998 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1072311288 10:94157760-94157782 AATCAGAGGGTGAATGAGGCAGG - Intronic
1072454440 10:95563492-95563514 CACCTGTGGGAGGCTGAGGCAGG + Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072868888 10:99095072-99095094 CATCTTAGGGAGGCTGAGGCAGG + Intronic
1072871387 10:99124519-99124541 CACAGGAGGGAGCCTGAGGGAGG - Intronic
1073168408 10:101478825-101478847 CCTCTGTGGGAGGCTGAGGCAGG + Intronic
1074012219 10:109493746-109493768 CATATTTGGGAGACTGAGGCAGG + Intergenic
1074203403 10:111259510-111259532 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1076187387 10:128460197-128460219 CATCTGCGGGTGGCTGAGGCTGG + Intergenic
1077912681 11:6586951-6586973 CATAGGAGGGAAGCTGAGGGAGG + Intronic
1077938805 11:6818192-6818214 CATGGGAGGGGGACTGAGGTAGG + Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078569959 11:12449263-12449285 CCGTGGAGGGAGGCTGAGGCGGG - Intronic
1078592434 11:12655372-12655394 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1080414920 11:32060537-32060559 CTTAGGAGGGAGGCTGAGGCAGG + Intronic
1081315877 11:41629102-41629124 CTCAGGAGGGAGGCTGAGGCAGG + Intergenic
1081767439 11:45621411-45621433 CATGGGAGGGAGGCTGAGGTGGG - Intergenic
1082687748 11:56260614-56260636 CATGGGAGGGAGGCTGTGGGGGG - Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1082872268 11:57954077-57954099 CACAGGGGGGAGGCTGAGGCAGG + Intergenic
1082904913 11:58297176-58297198 CTTTAGAGGGATACTGAGGCAGG - Intergenic
1083200699 11:61119404-61119426 CATCTGCCAGAGACTGAGGCAGG + Exonic
1083506143 11:63159343-63159365 CATGGGAGGGAGCCTGTGGGAGG + Intronic
1083649113 11:64190746-64190768 CACCTTTGGGAGACTGAGGCAGG + Intronic
1083675945 11:64324684-64324706 CTGGGGAGGGAGGCTGAGGCAGG + Intergenic
1083693460 11:64426289-64426311 CAGCTGAGGGAGGCTGAGGCAGG - Intergenic
1083784945 11:64939207-64939229 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1083916031 11:65744300-65744322 CATGGGAGGGAGGCCAAGGCGGG + Intergenic
1084016316 11:66384584-66384606 CTTGGGAGGGAGACAGAGGCGGG + Intergenic
1084187206 11:67480476-67480498 CTACTCAGGGAGACTGAGGCAGG - Intergenic
1084557498 11:69883690-69883712 CATCGGAGGGGCTCTGAGGCAGG + Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085496827 11:76978041-76978063 CATGGGAGGGAGGCCGAGGCGGG + Intronic
1085509031 11:77076241-77076263 AATCCCAGGGAGGCTGAGGCAGG + Intronic
1085906421 11:80769622-80769644 CATGGGAGGGACACTGTGGGAGG + Intergenic
1087114911 11:94514346-94514368 GTTCTGAGGGAGGCTGAGGCAGG - Intergenic
1087211109 11:95447063-95447085 CATCAGAGGGAGGCCGAGGTGGG - Intergenic
1087453462 11:98353589-98353611 CATGGGAGGGAGATTGAGGGAGG - Intergenic
1087473210 11:98603347-98603369 CCCAGGAGGGAGGCTGAGGCAGG + Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088470538 11:110184352-110184374 CATGTCAGGGAGACAGAGGCTGG - Intronic
1088702003 11:112421805-112421827 CCAGGGAGGGAAACTGAGGCTGG + Intergenic
1088931643 11:114357378-114357400 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
1089776505 11:120840598-120840620 CCTGGCAGGTAGACTGAGGCAGG + Intronic
1090751018 11:129746618-129746640 CAACGCAGGGAAGCTGAGGCTGG - Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091014766 11:132040034-132040056 CTCCAGAGGGAGGCTGAGGCAGG - Intronic
1091960562 12:4690596-4690618 CCCAGGAGGGAGACTGAGGCAGG + Exonic
1092229957 12:6770723-6770745 TACCGGAGGAAGAATGAGGCTGG - Exonic
1092276601 12:7066080-7066102 CTACCGAGGGAGGCTGAGGCAGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092808617 12:12251040-12251062 CCTACGAGGGAGGCTGAGGCAGG - Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093302318 12:17472230-17472252 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
1093348810 12:18071475-18071497 GTTGGGAGGGAGACTGAAGCAGG + Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094401368 12:30063939-30063961 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
1094499657 12:31010543-31010565 CAACTTAGGGAGGCTGAGGCAGG + Intergenic
1094677001 12:32630431-32630453 TTTCGGAGGGAGGTTGAGGCAGG + Intronic
1095149238 12:38771351-38771373 GCTAGGAGGGAGACTGAGGTGGG + Intronic
1095543168 12:43334528-43334550 GAACTTAGGGAGACTGAGGCAGG + Intergenic
1096058663 12:48677671-48677693 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1096531103 12:52243351-52243373 CTGTGGAGGGAGACTCAGGCTGG + Intronic
1096877954 12:54645119-54645141 CAAGGGGTGGAGACTGAGGCTGG + Intronic
1097003888 12:55901204-55901226 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098548747 12:71739939-71739961 ACTCGGAGGGAGGCTGAGGCAGG - Intergenic
1098790528 12:74816740-74816762 CATGGGAGGGAGGCTGAGGTGGG + Intergenic
1098964544 12:76772966-76772988 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
1099010866 12:77289492-77289514 ACTCGAGGGGAGACTGAGGCAGG + Intergenic
1099013513 12:77319852-77319874 ACTCGAGGGGAGACTGAGGCAGG - Intergenic
1099463718 12:82956559-82956581 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1100941790 12:99731046-99731068 TTTGGGAGGGAGGCTGAGGCAGG - Intronic
1101090872 12:101283794-101283816 CAACAGTGGGAGGCTGAGGCAGG - Intronic
1101261809 12:103039834-103039856 CATAGCAGGGAGACTGTGTCTGG - Intergenic
1102295877 12:111736296-111736318 CCTGGGAGGGAGGCTGAGACAGG - Intronic
1102538271 12:113598591-113598613 CCTAGTAGGGAGGCTGAGGCAGG + Intergenic
1103617277 12:122162323-122162345 CATGGCAGGGATGCTGAGGCTGG + Intergenic
1103893152 12:124254885-124254907 AAGAGGAGGGATACTGAGGCTGG + Intronic
1104003072 12:124872838-124872860 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
1104614704 12:130258017-130258039 AAGCTGGGGGAGACTGAGGCAGG + Intergenic
1104742480 12:131188630-131188652 CATGGGAGGGAGGCTGAGGGGGG + Intergenic
1104847458 12:131853721-131853743 CACCTCAGGGAGGCTGAGGCGGG - Intergenic
1105614864 13:22002509-22002531 CAATGGAGGGACACTGAAGCTGG + Intergenic
1105862960 13:24433067-24433089 GTTGGGAGGGAAACTGAGGCAGG + Intronic
1106148370 13:27073101-27073123 CACCACATGGAGACTGAGGCTGG + Intronic
1106193414 13:27473811-27473833 CATCGGGGTCAGACAGAGGCAGG - Intergenic
1106265458 13:28105579-28105601 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1106475536 13:30095096-30095118 CATGGGAGGGACACTGTGGGAGG + Intergenic
1107266007 13:38555057-38555079 GATAGTAGGGAGGCTGAGGCAGG + Intergenic
1107312479 13:39093929-39093951 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
1107797452 13:44067264-44067286 GTTAAGAGGGAGACTGAGGCCGG + Intergenic
1108011996 13:46025416-46025438 CAGCTGTGGGAGGCTGAGGCAGG - Intronic
1108319195 13:49271163-49271185 CAGCACTGGGAGACTGAGGCAGG + Intronic
1108329685 13:49372780-49372802 CTCTGGAGGGAGGCTGAGGCAGG - Intronic
1108536247 13:51382967-51382989 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1108844396 13:54660145-54660167 CATGTGAGGGAGACTGAGGGAGG - Intergenic
1108868596 13:54952963-54952985 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
1109470602 13:62799332-62799354 CATGGGAGGGAGTTTGAGGAGGG + Intergenic
1109606485 13:64704693-64704715 GTTGGGAGGGAAACTGAGGCAGG - Intergenic
1109687748 13:65843643-65843665 CATGGAAGGGAGACAGAGGTTGG + Intergenic
1109762249 13:66845254-66845276 CATGGGAGGGAGGCTGAAGTGGG - Intronic
1110342892 13:74413708-74413730 CATGGGAGGGAGGCTGAGGCAGG + Intergenic
1110776399 13:79412931-79412953 CTTGGAAGGGAGGCTGAGGCAGG + Intergenic
1111253626 13:85638867-85638889 CATGGGAGGGAGGCTGAAGGGGG - Intergenic
1111485658 13:88895707-88895729 CATGGGAGGGAGGCCAAGGCAGG + Intergenic
1111548000 13:89769124-89769146 CACCTGCGGGAGGCTGAGGCAGG + Intergenic
1111795192 13:92910495-92910517 CCTCAGAGGAAGACTGAGGGAGG + Intergenic
1111982584 13:95032773-95032795 CTACTCAGGGAGACTGAGGCAGG - Intronic
1112443867 13:99445844-99445866 CCTACTAGGGAGACTGAGGCAGG - Intergenic
1112822931 13:103357067-103357089 GATACTAGGGAGACTGAGGCAGG - Intergenic
1112917935 13:104574059-104574081 CATGGGATGGAGAGTGAGGGAGG + Intergenic
1113343991 13:109455834-109455856 CATCGGAGGGAGAAGAAGGCAGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113906976 13:113823859-113823881 CATCGGAGGGAGGCAGGGACAGG - Intronic
1114082840 14:19216425-19216447 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
1114188950 14:20426381-20426403 CAACTCAGGGAGGCTGAGGCAGG + Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114672541 14:24419161-24419183 CCAGGGAGGGAGAGTGAGGCTGG - Exonic
1115648967 14:35389694-35389716 CTCAGGAGGGAGGCTGAGGCAGG - Intergenic
1115683784 14:35771780-35771802 CCTTGTTGGGAGACTGAGGCAGG - Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1115714687 14:36089999-36090021 AATCCCAGGGAGGCTGAGGCGGG + Intergenic
1115718309 14:36130305-36130327 CATGGGAGGGAGCCTGTGGGAGG + Intergenic
1116381822 14:44278589-44278611 CTTCTCAGGGAGGCTGAGGCAGG - Intergenic
1116572161 14:46532073-46532095 CTTCTCAGGGAGGCTGAGGCAGG - Intergenic
1116919532 14:50558337-50558359 CAACAGAGGGAGACTGTGTCTGG + Intronic
1117199340 14:53372376-53372398 CATAGGAGGAAGGGTGAGGCTGG + Intergenic
1117551647 14:56843108-56843130 CAGCTGAGGGAGGCTGAGGCAGG - Intergenic
1117733977 14:58751140-58751162 CATGGGAGGGAGCCTGAGTGGGG + Intergenic
1118187894 14:63554242-63554264 CTTGGGAGGCTGACTGAGGCAGG - Intergenic
1118200141 14:63663820-63663842 CATGGGAGGGAGGCTGAGTGGGG - Intergenic
1118454447 14:65931887-65931909 CAGCTGAGAGAGACTGAGGAAGG + Intergenic
1118579803 14:67284480-67284502 CATACTAGGGAGGCTGAGGCAGG + Intronic
1118994785 14:70825910-70825932 CAACTAAGGGAGGCTGAGGCGGG + Intergenic
1119036135 14:71231619-71231641 CACTGGAGGGAGGCTGAGGGGGG + Intergenic
1119113110 14:71994207-71994229 TAACAGCGGGAGACTGAGGCTGG - Intronic
1119128321 14:72149024-72149046 CAGCTGGGGGAGCCTGAGGCTGG + Intronic
1119257229 14:73208932-73208954 CATGGGAGGGAGACTGAGGAGGG - Intronic
1119835076 14:77742141-77742163 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1120339830 14:83204911-83204933 CATGTTAGGGAGGCTGAGGCAGG - Intergenic
1120585204 14:86304009-86304031 ACTCGGGGGGAGGCTGAGGCAGG - Intergenic
1120856399 14:89216509-89216531 GCAGGGAGGGAGACTGAGGCAGG - Intronic
1120990494 14:90372669-90372691 TTTGGGAGGGAGGCTGAGGCGGG - Intergenic
1121549628 14:94789051-94789073 CTTGGGAGGGAGGCTGAGGCAGG - Intergenic
1121869720 14:97395928-97395950 GATCTTTGGGAGACTGAGGCAGG - Intergenic
1121905235 14:97735219-97735241 CTAGGGAGGGAGGCTGAGGCAGG - Intergenic
1122288601 14:100667561-100667583 CGTAGGAGGGAGACTGAGGCTGG + Intergenic
1122370025 14:101224554-101224576 CAGGGAAGGGACACTGAGGCAGG + Intergenic
1122421878 14:101582936-101582958 CATCTAAGGGAAACTGAGTCAGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122684504 14:103494430-103494452 AATCCCAGGGAGACTGAGGCAGG + Intronic
1202909593 14_GL000194v1_random:104625-104647 CACAGGAGGGAGGCTGAGGTGGG + Intergenic
1123707649 15:22961624-22961646 CATCTTTGGGAGGCTGAGGCTGG - Intronic
1123763032 15:23447039-23447061 CATGGGAGGGGGCCTGGGGCTGG + Intronic
1123986584 15:25651700-25651722 CAGCTGAGGGAGGCTGAGGCAGG - Intergenic
1124240862 15:28026714-28026736 CACCTCAGGGAGTCTGAGGCGGG + Intronic
1124375260 15:29125516-29125538 CATCGAGGGGAGACTGAGCCAGG + Intronic
1124515057 15:30360870-30360892 ACTCGGGGGGAGGCTGAGGCAGG + Intergenic
1124727865 15:32169857-32169879 ACTCGGGGGGAGGCTGAGGCAGG - Intronic
1124793671 15:32754306-32754328 CCCAGGAGGGAGACTGAGGCAGG + Intergenic
1124820806 15:33044166-33044188 CATGGGATGGAGGCTGAGGAGGG + Intronic
1124869586 15:33527470-33527492 CTCAGGAGGGAGGCTGAGGCAGG + Intronic
1125149950 15:36520136-36520158 CATCAGCAGGAGGCTGAGGCAGG + Intergenic
1125299416 15:38238578-38238600 CATGGAAGGGAGGCTGTGGCAGG + Intergenic
1126163580 15:45635145-45635167 CAGCGGAGGGAGACTGGGCGGGG + Intronic
1126165891 15:45653572-45653594 CTTGGGAGGGAGAATGGGGCTGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127078102 15:55348098-55348120 CAGCTGAGGCAGGCTGAGGCAGG - Intronic
1127305372 15:57700476-57700498 CGTGGGAGGGAGGCTGAGGTGGG + Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128057687 15:64712854-64712876 CTTGGGAGGGAGGCTGAGGCAGG - Intergenic
1128153417 15:65377455-65377477 CCCCGGAGGAAGACTGGGGCAGG - Intronic
1129818389 15:78576685-78576707 GATAGGAGGGAGGCTGAGGTGGG + Intronic
1129960556 15:79680842-79680864 CCTCGTAGTGAGACTGAGGATGG - Intergenic
1130111850 15:80971836-80971858 CTTGGGAGGGAGGCTGAGGTGGG + Intronic
1130260359 15:82349240-82349262 CATCGGAGGGGATCTGTGGCTGG + Intronic
1130268370 15:82430193-82430215 CATCGGAGGGGATCTGTGGCTGG - Intronic
1130280873 15:82519767-82519789 CATCGGAGGGGATCTGTGGCTGG - Intergenic
1130472244 15:84235948-84235970 CATCGGAGGGGATCTGTGGCTGG - Intronic
1130479737 15:84350519-84350541 CATCGGAGGGGATCTGTGGCTGG - Intergenic
1130483872 15:84386952-84386974 CATCGGAGGGGATCTGTGGCTGG - Intergenic
1130492033 15:84437610-84437632 CATCGGAGGGGATCTGTGGCTGG + Intergenic
1130503650 15:84516650-84516672 CATCGGAGGGGATCTGTGGCTGG + Intergenic
1130594542 15:85240585-85240607 CATCGGAGGGGATCTGTGGCTGG - Intergenic
1132534188 16:469181-469203 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1132664144 16:1073988-1074010 CAGGAGAGGGAAACTGAGGCAGG - Intergenic
1132923799 16:2416247-2416269 CAGAGGCGGGAGGCTGAGGCGGG + Intergenic
1132947741 16:2541346-2541368 CACCGGTGGGAGACGGAGTCTGG + Intronic
1134102612 16:11462539-11462561 AATCCCAGGGAGGCTGAGGCAGG - Intronic
1134283750 16:12841826-12841848 CAGCTCAGGGAGGCTGAGGCAGG - Intergenic
1134300855 16:12989422-12989444 CACCCGGGGGAGGCTGAGGCAGG - Intronic
1134470577 16:14521688-14521710 CACGGGAGGGAGGCTGAGGCAGG + Intronic
1134476685 16:14580214-14580236 CAACTTTGGGAGACTGAGGCAGG - Intronic
1134490829 16:14694227-14694249 CATCGGAGGGTGGCAGAGGTGGG + Exonic
1134496210 16:14733345-14733367 CATCGGAGGGTGGCAGAGGTGGG + Intronic
1134615422 16:15647782-15647804 TTTGGGAGGGAGGCTGAGGCAGG + Intronic
1134623267 16:15705871-15705893 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1134741880 16:16555052-16555074 CTTGGGAGGGAGGTTGAGGCAGG - Intergenic
1134925678 16:18157404-18157426 CTTGGGAGGGAGGTTGAGGCAGG + Intergenic
1135188945 16:20338736-20338758 CATAGCAGGGAGGCCGAGGCAGG - Intronic
1135273352 16:21087649-21087671 TATGAGAGGGAGGCTGAGGCAGG + Intronic
1135280636 16:21151430-21151452 CACTGGTGGGAGGCTGAGGCAGG - Intronic
1136154591 16:28374485-28374507 CATCGGAGGGTGGCAGAGGTGGG - Intergenic
1136208500 16:28740779-28740801 CATCGGAGGGTGGCAGAGGTGGG + Intergenic
1136264584 16:29107443-29107465 CATCGGAGGGTGGCAGAGGTGGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136750856 16:32634439-32634461 CTCCTTAGGGAGACTGAGGCAGG + Intergenic
1137624362 16:49898407-49898429 CAGGTGAGGGAGTCTGAGGCAGG - Intergenic
1137690767 16:50425613-50425635 CATGGGTGGGAGCCTGGGGCAGG - Intergenic
1138169356 16:54834332-54834354 ACTCGGTGGGAGGCTGAGGCAGG + Intergenic
1138175835 16:54897493-54897515 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1138335161 16:56247109-56247131 CAACGGAGGGGAGCTGAGGCGGG - Intronic
1138447645 16:57074596-57074618 CAGCAGAAGGTGACTGAGGCTGG - Exonic
1139015446 16:62684180-62684202 CACTGGAGGGAGACTGAGGAGGG + Intergenic
1139378559 16:66515962-66515984 CACTGGAGGGAGACAGAGGCTGG - Intronic
1139473973 16:67193281-67193303 CTGAGGAGGGAGCCTGAGGCTGG - Intronic
1139524469 16:67505769-67505791 CAACGCTGGGAGACTGAGGTGGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139763943 16:69210877-69210899 GCTCCTAGGGAGACTGAGGCAGG + Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140037181 16:71380418-71380440 GCTCGGCGGGAGGCTGAGGCAGG - Intronic
1140206846 16:72940156-72940178 CAACACAGGGAGGCTGAGGCAGG - Intronic
1140218420 16:73026259-73026281 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1140305364 16:73797923-73797945 AATCCCAGGGAGGCTGAGGCAGG - Intergenic
1140673384 16:77301602-77301624 CACCCGAGGGAGACAGAGCCAGG - Intronic
1140679089 16:77366444-77366466 CCTAGTAGGGAGTCTGAGGCAGG + Intronic
1140865665 16:79059600-79059622 CTTGGGAGGCAGGCTGAGGCAGG - Intronic
1140885028 16:79235452-79235474 CACTGGAGGGAGGCTGAGGTGGG + Intergenic
1141470635 16:84236108-84236130 CACTGCAGGGAAACTGAGGCCGG + Intronic
1141574353 16:84954525-84954547 AAGCCCAGGGAGACTGAGGCTGG + Intergenic
1141661195 16:85442525-85442547 CACAGGAGGTAAACTGAGGCTGG + Intergenic
1141951143 16:87340173-87340195 CTTGGGAGTGAGGCTGAGGCAGG + Intronic
1142147284 16:88497896-88497918 TATCGGGTGGAGGCTGAGGCGGG + Intronic
1142289011 16:89184215-89184237 CACGGGAAGGAAACTGAGGCGGG - Intronic
1142338182 16:89503805-89503827 CTCAGGAGGGAGACTGAGGCAGG - Intronic
1142358009 16:89613124-89613146 GTTGGGAGGGAAACTGAGGCAGG - Intergenic
1203052991 16_KI270728v1_random:893703-893725 CTCCTTAGGGAGACTGAGGCAGG + Intergenic
1142558644 17:796672-796694 CAGGGAAGGGAGGCTGAGGCCGG - Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143024126 17:3930892-3930914 CATCCCAGGGAGGCGGAGGCGGG + Intronic
1143065407 17:4243443-4243465 CAGCTGTGGGAGGCTGAGGCAGG - Intronic
1143132014 17:4684810-4684832 GCTAGGAGGGAGGCTGAGGCAGG - Intronic
1143232939 17:5372865-5372887 CTAGGGAGGGAGGCTGAGGCCGG - Intronic
1143522226 17:7451386-7451408 CCGGGGAGGGAGGCTGAGGCAGG - Intronic
1143619366 17:8072302-8072324 CCTGGGAGGGAGACTTAAGCTGG + Intergenic
1143648655 17:8248853-8248875 CTTAGGAGGGAGACGGAGGCTGG - Intronic
1143780171 17:9225141-9225163 AATCCCAGGGAGGCTGAGGCAGG + Intronic
1143874986 17:9984884-9984906 CCTAGGAAGGAGCCTGAGGCTGG - Intronic
1144128769 17:12225888-12225910 TAATGGAGGGAGCCTGAGGCAGG + Intergenic
1145109306 17:20147928-20147950 CTTGGGAGGGAGGCTGAGGTGGG + Intronic
1145910571 17:28539745-28539767 CTCAGGAGGGAGGCTGAGGCAGG + Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146359119 17:32159733-32159755 CATGGGAGGGAGGCTGAGATGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146554770 17:33813923-33813945 CAGTGGAGGGAGAATGAGGAAGG + Intronic
1146793500 17:35765939-35765961 AGTGGGAGGGAGACTGATGCAGG - Intronic
1146796830 17:35787600-35787622 GATAGTCGGGAGACTGAGGCAGG - Intronic
1146807239 17:35874545-35874567 CATTTTAGGGAGATTGAGGCAGG - Intronic
1146963673 17:37006355-37006377 GCTAGTAGGGAGACTGAGGCAGG + Intronic
1147319831 17:39639492-39639514 TATCAGAGGGAGGCAGAGGCTGG + Intronic
1147520923 17:41172621-41172643 CAGAGAAGGGAGGCTGAGGCGGG + Intergenic
1147757843 17:42780406-42780428 CCTCAGAGTGAGACTGCGGCCGG + Intergenic
1147950360 17:44104191-44104213 CATACTCGGGAGACTGAGGCAGG + Intronic
1148272102 17:46269418-46269440 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1148778332 17:50108353-50108375 GATGGGTGGGAGAATGAGGCTGG - Exonic
1148860360 17:50601356-50601378 CATAGAAGGGAAACTGAGGCAGG - Intronic
1148911622 17:50946070-50946092 TTAGGGAGGGAGACTGAGGCAGG + Intergenic
1149256896 17:54837016-54837038 CATGGGAGGGAAGCTGAGGTGGG - Intergenic
1149830391 17:59866893-59866915 CTACTGGGGGAGACTGAGGCAGG - Intronic
1150080905 17:62237382-62237404 GATACTAGGGAGACTGAGGCAGG + Intergenic
1150156909 17:62861396-62861418 CTTGGGAGGGAGGCTGAGCCAGG - Intergenic
1150420343 17:65028295-65028317 CTTGGGAGGGAGGTTGAGGCAGG + Intronic
1150521000 17:65866346-65866368 CATGGGAGGGAGGCCAAGGCGGG + Intronic
1150725403 17:67647562-67647584 CATCTTTGGGAGGCTGAGGCGGG - Intronic
1151274827 17:73026401-73026423 GATAGTTGGGAGACTGAGGCAGG + Intronic
1151457632 17:74235780-74235802 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1151534072 17:74727540-74727562 CACAGCAGGGACACTGAGGCAGG - Intronic
1151565872 17:74897995-74898017 CTGCTGAGGGAGGCTGAGGCAGG - Intergenic
1151606741 17:75142446-75142468 CTACGCAGGGAGGCTGAGGCAGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152530315 17:80914718-80914740 CATGGGAGGGAGGCTGAGGGTGG + Intronic
1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG + Intronic
1152656052 17:81519655-81519677 CACCGGACGGTGACAGAGGCAGG + Intronic
1152795101 17:82302746-82302768 CCTGGGAGGGAGACTGGGGAGGG + Intergenic
1152856655 17:82668504-82668526 CATGGGAGGGAAGCTGAGGGAGG - Intronic
1153608132 18:6855021-6855043 CATGGGAGGGAGGCCGAGGTGGG + Intronic
1153914244 18:9732085-9732107 GAGCTGAGGGAGACGGAGGCTGG - Intronic
1154357577 18:13633511-13633533 CATCAGTGGGAGGCTGAGGCAGG - Intronic
1156281675 18:35645339-35645361 CTTGGGAAGGAGGCTGAGGCAGG - Intronic
1157236042 18:45966262-45966284 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1157599776 18:48886853-48886875 CCTGGCAGGGACACTGAGGCAGG - Intergenic
1157830150 18:50850167-50850189 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1158641447 18:59207289-59207311 CATCTTTGGGAGGCTGAGGCGGG + Intergenic
1159044631 18:63357695-63357717 CTCAGGAGGGAGGCTGAGGCAGG - Intronic
1159594992 18:70374438-70374460 CTTTGGTGGGAGGCTGAGGCAGG + Intergenic
1160716253 19:578148-578170 CACAGGAGGGAAACTGAGGGAGG - Intronic
1160868246 19:1265634-1265656 AACAGGAGGGAAACTGAGGCTGG + Intronic
1160878397 19:1308499-1308521 CAGCCCAGGGAGAATGAGGCTGG + Intergenic
1160955181 19:1688049-1688071 CATCGGAGGGCGACTGACGAGGG + Intergenic
1161241085 19:3224506-3224528 CCGCGGGGGGAAACTGAGGCCGG - Intergenic
1161327687 19:3671410-3671432 CCACAGAGGGAAACTGAGGCAGG - Intronic
1161349746 19:3785139-3785161 CCCCAGAGGGAAACTGAGGCAGG + Intronic
1161660136 19:5540729-5540751 TAAGGGAGGGAAACTGAGGCTGG + Intergenic
1162024124 19:7884214-7884236 CTTGGGAGGGAGGGTGAGGCAGG + Intergenic
1162030346 19:7914550-7914572 CATTGAGGGGAGACTGAGGCAGG + Intergenic
1162600034 19:11661861-11661883 CCCCAGAGGGAGGCTGAGGCGGG - Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162899683 19:13787230-13787252 CATTACAGGGAGGCTGAGGCAGG + Intergenic
1163355174 19:16805978-16806000 CTTGGAAGGGAGGCTGAGGCAGG - Intronic
1163427908 19:17249152-17249174 AAAAGGAGGGAGACTGAAGCTGG - Intronic
1163553683 19:17980792-17980814 CCTCAGGAGGAGACTGAGGCAGG + Intronic
1164000632 19:21095178-21095200 GTTGGGAGGGAAACTGAGGCAGG + Intronic
1164029858 19:21394292-21394314 TATTGTAGGGAGGCTGAGGCAGG + Intergenic
1164148926 19:22532286-22532308 CATCAGAGGGATTCTGGGGCTGG + Intronic
1164187258 19:22881235-22881257 CTTGGGTGGGAGGCTGAGGCAGG - Intergenic
1164501003 19:28820321-28820343 CCTCACAGGGAGGCTGAGGCTGG + Intergenic
1164953119 19:32355753-32355775 CACAGGAGGGAGGCCGAGGCGGG + Intronic
1165010754 19:32844581-32844603 CAGCACTGGGAGACTGAGGCAGG + Intronic
1165107064 19:33476773-33476795 GCTCTTAGGGAGACTGAGGCAGG - Intronic
1165289069 19:34868554-34868576 CTCGGGAGGGAGGCTGAGGCAGG - Intergenic
1165376666 19:35447797-35447819 CATCCCAGGGAGGCTGACGCAGG + Intronic
1165389597 19:35530674-35530696 CAGAGGAGAGGGACTGAGGCTGG - Intergenic
1165616198 19:37203366-37203388 GCTAGGAGGGAGGCTGAGGCAGG + Intronic
1166096267 19:40541376-40541398 CAGCAGAGGGAGCCCGAGGCAGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166187429 19:41150283-41150305 CAGGTGAGGGAGGCTGAGGCAGG - Intergenic
1166861606 19:45814861-45814883 CATCAGAGTAAGGCTGAGGCTGG + Exonic
1167001932 19:46750635-46750657 CTTAGGAGGGAGGCTGAGGCAGG - Intronic
1167147086 19:47688176-47688198 CTCAGGAGGGAGGCTGAGGCAGG + Intronic
1167538624 19:50071400-50071422 GCTCGTAGGGAGACAGAGGCTGG + Intergenic
1167588871 19:50391669-50391691 CATCAGAGGGAGACTGAGAGGGG + Intronic
1167841667 19:52126655-52126677 CTACTCAGGGAGACTGAGGCAGG + Intronic
1167844948 19:52154546-52154568 CTACTCAGGGAGACTGAGGCAGG + Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167965147 19:53138224-53138246 CTCCTCAGGGAGACTGAGGCAGG - Intronic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168055383 19:53861348-53861370 CTTCTTTGGGAGACTGAGGCAGG + Intergenic
1168293961 19:55369902-55369924 CTCCGGAGGGAAACTGAGGCAGG - Intronic
1168317786 19:55491563-55491585 GCATGGAGGGAGACTGAGGCAGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925645950 2:6037242-6037264 CAACATCGGGAGACTGAGGCAGG - Intergenic
926238378 2:11067254-11067276 CATGCCAGGGACACTGAGGCAGG + Intergenic
926325810 2:11784561-11784583 GATCGCAGGGGGACTGAGGGTGG - Intronic
927745976 2:25621556-25621578 AATCCTAGGGAGGCTGAGGCAGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928137228 2:28696669-28696691 CAGCGATGGGAGGCTGAGGCAGG + Intergenic
928271199 2:29856653-29856675 CATCGTAGGCAGACAGAGGATGG - Intronic
928510274 2:31996430-31996452 CAGCTGAGGGAGGCTAAGGCAGG + Intronic
928551854 2:32380478-32380500 CAGCTGAGGGAGGCTGAGGCGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928585897 2:32757803-32757825 CTTGGGTGGGAGGCTGAGGCAGG - Intronic
929514265 2:42592148-42592170 CAGCTAAGGGAGGCTGAGGCAGG + Intronic
929700352 2:44157293-44157315 AATCCCAGGGAGGCTGAGGCAGG - Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929784488 2:44979482-44979504 CTCCGGAGGGAGGCTGAGGCAGG - Intergenic
929814469 2:45220200-45220222 CCTCGCAGGGAAACTGGGGCTGG + Intergenic
931019222 2:58024095-58024117 CTTGGGAGGGAGGCTGAGACAGG - Intronic
931346594 2:61452566-61452588 CTTTGGCGGGAGGCTGAGGCGGG - Intronic
931348357 2:61467394-61467416 CCTCGGCAGGAGGCTGAGGCAGG - Intronic
931503167 2:62893931-62893953 GCTAGTAGGGAGACTGAGGCAGG + Intronic
931733986 2:65177684-65177706 CATGGGAGGGAGGCTGAGTGGGG - Intergenic
931841879 2:66159980-66160002 AAGCAGAGGGAGGCTGAGGCAGG + Intergenic
932396811 2:71454248-71454270 ACTCAGAGGGAAACTGAGGCTGG + Intronic
933852797 2:86384661-86384683 CTACTGAGGGAGGCTGAGGCAGG + Intergenic
933943800 2:87267078-87267100 CATGGGAGGGACACAGTGGCAGG + Intergenic
934177880 2:89593260-89593282 CTTGGCAGGGATACTGAGGCAGG + Intergenic
934288178 2:91667561-91667583 CTTGGCAGGGATACTGAGGCAGG + Intergenic
934533286 2:95110554-95110576 GAACTGTGGGAGACTGAGGCAGG + Intronic
934536743 2:95140499-95140521 AATCCCAGGGAGGCTGAGGCAGG + Intronic
934694377 2:96388599-96388621 GCTCCTAGGGAGACTGAGGCAGG - Intergenic
935290425 2:101605891-101605913 TATCCTAGGGAGGCTGAGGCAGG + Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935955370 2:108371527-108371549 ACTCGGGGGGAGGCTGAGGCAGG - Intergenic
936049185 2:109210483-109210505 CATCCCAGGGAGACAGTGGCTGG + Intronic
936336420 2:111594501-111594523 CATGGGAGGGACACAGTGGCAGG - Intergenic
937373031 2:121315564-121315586 CTACTGGGGGAGACTGAGGCAGG + Intergenic
937485861 2:122314191-122314213 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
937772670 2:125739323-125739345 CATAGCAGGGAGGCTGAGGTGGG - Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938485855 2:131707298-131707320 CCACTTAGGGAGACTGAGGCAGG - Intergenic
938493736 2:131780194-131780216 CTTGGGAGGGAGGCTGAGGTGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938819135 2:134936640-134936662 CTTCTCAGGGAGGCTGAGGCAGG + Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
940953414 2:159702930-159702952 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
941131015 2:161650792-161650814 CATGGGAGGGAGGCTGAGTGGGG + Intronic
942816130 2:180056529-180056551 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
942816746 2:180061109-180061131 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
943298969 2:186173458-186173480 GTTGGGAGGGAAACTGAGGCAGG - Intergenic
943396212 2:187338641-187338663 CATGGGAGGGAGGCAGAGGTGGG - Intergenic
943673645 2:190694380-190694402 CATCTTTGGGAGGCTGAGGCGGG + Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
943956088 2:194191820-194191842 GATGATAGGGAGACTGAGGCGGG - Intergenic
944343640 2:198634167-198634189 CACTGGTGGGAGGCTGAGGCAGG + Intergenic
945087604 2:206148540-206148562 TATGGGAGGGAGGCTGAGGCAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945511013 2:210702726-210702748 AAGATGAGGGAGACTGAGGCAGG + Intergenic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946400391 2:219465414-219465436 CAGAGGAGGGGAACTGAGGCAGG - Intronic
946601216 2:221362260-221362282 CATCGTTGGGAGGCTGAGGTGGG - Intergenic
946678254 2:222185456-222185478 CTACTCAGGGAGACTGAGGCAGG + Intergenic
947586865 2:231361854-231361876 AATCGGAGAGAGAAAGAGGCAGG + Intronic
947603546 2:231469122-231469144 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
947781062 2:232763717-232763739 CTACTGAGGGAGACTGAGGCAGG + Intronic
947958435 2:234214429-234214451 GATAGGTGGGAGGCTGAGGCAGG + Intergenic
948872154 2:240807255-240807277 CATACTAGGGAGGCTGAGGCAGG - Intronic
948957645 2:241306371-241306393 CAGCTGTGGGAGGCTGAGGCAGG - Intronic
1168883826 20:1229401-1229423 AATTGTAGGGAGGCTGAGGCAGG + Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169782233 20:9322057-9322079 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
1169782463 20:9324061-9324083 CTCAGGAGGGAGGCTGAGGCAGG + Intronic
1169865395 20:10194772-10194794 CTCAGGAGGGAGGCTGAGGCAGG - Intergenic
1169904321 20:10585696-10585718 CTCAGGAGGGAGGCTGAGGCAGG - Intronic
1170458323 20:16553982-16554004 CATGGGAGGGAGGCTGAGGTGGG + Intronic
1171005149 20:21457346-21457368 GAATGGAGGGAGACTGAGGTAGG + Intergenic
1171156694 20:22880900-22880922 CATCGGAGGGTGAGAGAAGCTGG + Intergenic
1171240990 20:23566774-23566796 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1171259960 20:23723599-23723621 CATCTGACGGAAACTAAGGCGGG + Intergenic
1172446463 20:34995986-34996008 CACAGGAGGGAAAGTGAGGCAGG + Intronic
1172484455 20:35290083-35290105 CTTCACAGGGAAACTGAGGCAGG - Intronic
1172849214 20:37948511-37948533 CAGGAGAGGGAGGCTGAGGCAGG + Intergenic
1173404282 20:42751672-42751694 CATAGGAGGAAGACGAAGGCAGG - Intronic
1173791799 20:45832893-45832915 CCTCTGAGGGAGGCAGAGGCAGG + Intronic
1174811065 20:53646319-53646341 GATACGCGGGAGACTGAGGCAGG + Intergenic
1175303016 20:57956314-57956336 CCTGGGAAGGAGACTGTGGCAGG - Intergenic
1175938105 20:62524461-62524483 CACCTGAGGGGGGCTGAGGCAGG - Intergenic
1176255049 20:64147300-64147322 CATCTGAGGGAGGCTGCGGCTGG - Intergenic
1176415788 21:6474090-6474112 AATCCCAGGGAGGCTGAGGCAGG - Intergenic
1176547807 21:8209026-8209048 CAAGGGAGGGCGACCGAGGCCGG - Intergenic
1176555699 21:8253228-8253250 CAAGGGAGGGCGACCGAGGCCGG - Intergenic
1176566750 21:8392063-8392085 CAAGGGAGGGCGACCGAGGCCGG - Intergenic
1176614170 21:9014182-9014204 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
1176628943 21:9119333-9119355 CACAGGAGGGAGGCTGAGGTGGG + Intergenic
1177344681 21:19854079-19854101 CATGGGAGGGAGGCCGAGGTGGG - Intergenic
1177492314 21:21843523-21843545 GCTAGGAGGGAGGCTGAGGCAGG - Intergenic
1177821954 21:26040648-26040670 AATCCTCGGGAGACTGAGGCAGG + Intronic
1177902873 21:26938130-26938152 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1178027347 21:28483306-28483328 CATCAGAAGGAGACTCAGGATGG + Intergenic
1178517847 21:33263964-33263986 CTTGCGAGGGAGGCTGAGGCAGG - Exonic
1179519418 21:41932287-41932309 CATCGAAGGGATGCTTAGGCGGG - Intronic
1179691288 21:43082424-43082446 AATCCCAGGGAGGCTGAGGCAGG - Intergenic
1180021272 21:45129115-45129137 CAGCCTCGGGAGACTGAGGCAGG + Intronic
1180497939 22:15906244-15906266 CTTGGGAGGGAGGCTGAGGTGGG - Intergenic
1180611510 22:17101163-17101185 AATTGTAGAGAGACTGAGGCAGG - Intronic
1180656197 22:17422994-17423016 CATCGGAAGCAGACTGAGAGAGG - Intronic
1180691609 22:17721056-17721078 ACTCGGGGGGAGGCTGAGGCAGG + Intronic
1180756898 22:18168638-18168660 AATCCCAGGGAGGCTGAGGCAGG - Intronic
1180886536 22:19248795-19248817 TTTGGGAGGGAGGCTGAGGCAGG - Intronic
1181138099 22:20783503-20783525 CTGGGGAGGGAGGCTGAGGCAGG + Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181590278 22:23879965-23879987 AATCCCAGGGAGGCTGAGGCGGG + Intronic
1182231339 22:28839660-28839682 CATCCTTGGGAGACTGATGCAGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182706818 22:32287730-32287752 CAACTTTGGGAGACTGAGGCAGG - Intergenic
1183143466 22:35967066-35967088 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1183295771 22:37028602-37028624 CCTCGGGGGGAAGCTGAGGCAGG + Intronic
1183618646 22:38960041-38960063 GCACGGAGAGAGACTGAGGCAGG + Intronic
1183661495 22:39224141-39224163 AATAGGAGGGAGACTGTGGTAGG - Exonic
1183783093 22:40011301-40011323 AATCCCAGGGAGGCTGAGGCAGG - Intronic
1183892011 22:40937218-40937240 TATCTGCGGGAGGCTGAGGCAGG + Intergenic
1183943763 22:41312043-41312065 CATCCTCGGGAGGCTGAGGCAGG + Intronic
1184004561 22:41698814-41698836 TTTGGGAGGGAGGCTGAGGCAGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184375530 22:44109865-44109887 CATAGGTGGGAGGCCGAGGCGGG + Intronic
1184534635 22:45078030-45078052 GAGCCGGGGGAGACTGAGGCGGG + Intergenic
1184697906 22:46150237-46150259 CAGCCAAGGGAAACTGAGGCCGG - Intergenic
1203252681 22_KI270733v1_random:125311-125333 CAAGGGAGGGCGACCGAGGCCGG - Intergenic
949218425 3:1600333-1600355 CCTCCAAGGGAGACTGAGTCAGG + Intergenic
949241583 3:1879530-1879552 CATAGCCGAGAGACTGAGGCAGG - Intergenic
949871075 3:8589649-8589671 CAGATGAGGGAAACTGAGGCTGG - Intergenic
950158804 3:10743635-10743657 CCCTAGAGGGAGACTGAGGCTGG + Intergenic
950448411 3:13051766-13051788 TAGCAGAGGGAAACTGAGGCAGG - Intronic
950910980 3:16591539-16591561 CTTCAGAGGGAGGCTGAGGTAGG - Intronic
951738905 3:25898514-25898536 CAGCTGCGGGAGGCTGAGGCAGG - Intergenic
951819691 3:26794387-26794409 CATAGGAGGGATACTGGAGCTGG + Intergenic
951877338 3:27441732-27441754 CAACACTGGGAGACTGAGGCAGG - Intronic
952255054 3:31687823-31687845 CAACAGTGGGAGGCTGAGGCAGG + Intronic
952442060 3:33340778-33340800 GATCCTAGGGAGACTGAGGCAGG + Intronic
952473631 3:33683359-33683381 AATTCCAGGGAGACTGAGGCGGG + Intronic
952917529 3:38260118-38260140 CATCTTTGGGAGGCTGAGGCAGG - Intergenic
952944329 3:38467329-38467351 CCCAGGAGGGAGGCTGAGGCAGG + Intronic
953099581 3:39810987-39811009 CAGGGGAGGAAGACTGAGACTGG + Intronic
953133914 3:40166678-40166700 CATGGGAGGCAGTGTGAGGCAGG + Intronic
953408744 3:42675683-42675705 CAGCTACGGGAGACTGAGGCAGG - Intergenic
953593621 3:44285679-44285701 CTACTCAGGGAGACTGAGGCAGG - Intronic
953650984 3:44803961-44803983 CCCAGGAGGGAGCCTGAGGCAGG - Intronic
953831092 3:46298087-46298109 CATGGGAGGGAGACTTTGACAGG + Intergenic
953839515 3:46377949-46377971 CTTCGGTGGGAGGCCGAGGCGGG - Intergenic
954158888 3:48705539-48705561 CATGGTGGGGAGACTGAGGTGGG + Intronic
954184664 3:48907639-48907661 AATCCATGGGAGACTGAGGCAGG + Intergenic
954190760 3:48958766-48958788 CTTCGGGAGGAGGCTGAGGCAGG + Intronic
954246533 3:49336634-49336656 CAGCTACGGGAGACTGAGGCAGG - Intronic
954388178 3:50255254-50255276 CATGGCAGGGATATTGAGGCAGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954559251 3:51542555-51542577 AATCCCAGGGAGGCTGAGGCGGG - Intronic
955231381 3:57102012-57102034 CATGAGAGGGAGGCTGAGGCAGG + Intronic
956130822 3:66052237-66052259 CTTGGGAGGGAGCCTGAGGCAGG + Intergenic
956816359 3:72911877-72911899 CATGGAGGGGATACTGAGGCAGG - Intronic
957047864 3:75390379-75390401 TTTGGGAGGGAGGCTGAGGCAGG + Intergenic
957680631 3:83428580-83428602 CAGCTGAGGCAGGCTGAGGCAGG + Intergenic
958012606 3:87899614-87899636 CAGCTGTGGGAGGCTGAGGCGGG + Intergenic
958263882 3:91414492-91414514 CTTAGTAGGGAGGCTGAGGCAGG - Intergenic
958987601 3:100800583-100800605 CTACGTAGGGAGGCTGAGGCAGG - Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960119506 3:113932991-113933013 ACTCGGTGGGAGGCTGAGGCAGG - Intronic
960498679 3:118408355-118408377 CACCTGATGGAGACTGAGCCAGG - Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960841292 3:121962389-121962411 CATGGGAGAGATACTGAGCCAGG + Intergenic
960996717 3:123345096-123345118 CATGGGAGAGAGACAGAGGGAGG + Intronic
961421861 3:126812533-126812555 CATACTAGGGAAACTGAGGCAGG - Intronic
961453776 3:127014458-127014480 CAGCTGAGGGAGGCAGAGGCTGG - Exonic
961525772 3:127496478-127496500 CATGGCAGGGAGGCTGAGGCAGG + Intergenic
961763492 3:129189562-129189584 CTTGGGAGGGAGGCTGAGGCAGG - Intergenic
961817816 3:129560301-129560323 CACAGAGGGGAGACTGAGGCCGG + Intronic
963240995 3:143002101-143002123 CCTTGGAGGGAAACTGAGGGAGG - Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963599018 3:147361170-147361192 CAACGGAGAGAAAATGAGGCAGG - Intergenic
963627210 3:147688830-147688852 CATGGGAGGGACACTGTGGGAGG - Intergenic
963805292 3:149715533-149715555 CCTCTAAGGGAGACTGAGTCAGG - Intronic
963827593 3:149971248-149971270 GGGCGGGGGGAGACTGAGGCGGG + Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
965074010 3:163953598-163953620 CATAGGAGGGAGGCTGGGGTGGG - Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
966898138 3:184461203-184461225 CTACTGAGGAAGACTGAGGCAGG - Intronic
966976723 3:185091341-185091363 TTTCTGAGGAAGACTGAGGCTGG + Intronic
966997069 3:185293362-185293384 AATCCCAGGGAGGCTGAGGCAGG - Intronic
967478461 3:189947411-189947433 CATGTGAGGAAGCCTGAGGCAGG - Intergenic
968240140 3:197072802-197072824 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG + Intronic
968979376 4:3838503-3838525 CATAGGAGGCAGACTTAGGGTGG - Intergenic
969030798 4:4211651-4211673 CCTGCTAGGGAGACTGAGGCAGG + Intronic
969823017 4:9734811-9734833 TTTGGGAGGGAGGCTGAGGCAGG - Intergenic
969831365 4:9800134-9800156 CTTGGCAGGGATACTGAGGCAGG - Intronic
970333197 4:15004379-15004401 CATGGGCGGGGGACGGAGGCGGG + Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970445307 4:16118991-16119013 AATCCCAGGGAGGCTGAGGCGGG + Intergenic
971046747 4:22813527-22813549 CATGGGAGAGAGACGTAGGCTGG - Intergenic
971207718 4:24585957-24585979 GCTAGGAGGGAGGCTGAGGCAGG - Intergenic
971330820 4:25680023-25680045 TTTGGGAGGGAGGCTGAGGCGGG + Intergenic
972471663 4:39411449-39411471 CTTTGACGGGAGACTGAGGCAGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
974036515 4:56822503-56822525 CTTGGGAGGGAGGCTGAGGTGGG - Intergenic
974179002 4:58360638-58360660 CATGGGAGGGAGACTGAGGTGGG - Intergenic
974260331 4:59518128-59518150 CATGGGAGAGAGGCTGAGGTTGG - Intergenic
974683537 4:65195217-65195239 CATGGGAGGGAGACTAAAGGGGG - Intergenic
974686863 4:65242288-65242310 CATGGGATGGAGGCTGAGGAGGG - Intergenic
975254384 4:72216392-72216414 CATGGAAGAGAGGCTGAGGCAGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976127226 4:81846732-81846754 ACTCGGAGGGAGGCTGAGGTGGG + Intronic
976565899 4:86550589-86550611 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
976789435 4:88861132-88861154 CATCTTTGGGAGTCTGAGGCGGG + Intronic
977303552 4:95295976-95295998 CATGGGGGGGAGGCTGAGGCAGG + Intronic
977359042 4:95980912-95980934 CATGGGAGGGAGGCTGATGGGGG + Intergenic
977442981 4:97093765-97093787 CAGCTGTGGGAGGCTGAGGCAGG - Intergenic
977899028 4:102397164-102397186 CAAAGGAGGAAGACTTAGGCCGG - Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978498427 4:109384459-109384481 CATGAGAGGGAGACTGAGTCAGG + Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979649007 4:123107740-123107762 CATGGGAGGGAGGCTGAGGAGGG - Intronic
980301470 4:130999872-130999894 CAACTGTGGGAGGCTGAGGCAGG - Intergenic
980545932 4:134261232-134261254 CATGGGAGGGAGCCTGGGGGAGG - Intergenic
980763384 4:137266549-137266571 CATGGGAGAAAGACAGAGGCCGG - Intergenic
981724776 4:147835482-147835504 CTACTCAGGGAGACTGAGGCAGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982268007 4:153557906-153557928 CAGTGGTGGGAGGCTGAGGCAGG - Intronic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
982802648 4:159723264-159723286 CATGGGAGGGAGGCTGAAGGAGG - Intergenic
983182296 4:164662664-164662686 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
983409076 4:167373266-167373288 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
984169480 4:176343486-176343508 CACAGGAGGGAGGCTGAGGTGGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984938766 4:184913089-184913111 GTTGGGAGGGAAACTGAGGCAGG - Intergenic
984947056 4:184977461-184977483 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
985666106 5:1182258-1182280 CCTCTTAGGGAGGCTGAGGCAGG - Intergenic
985849065 5:2375160-2375182 CAACTCAGGGAGGCTGAGGCAGG + Intergenic
987008024 5:13730944-13730966 TTTGGGAGGGAGGCTGAGGCGGG - Intronic
987840111 5:23212532-23212554 CTCGGGAGGGAGGCTGAGGCAGG - Intergenic
988346330 5:30042094-30042116 CATGGGAGTGAGGCTGAGGGGGG + Intergenic
988457447 5:31398959-31398981 GTTGGGAGGGAAACTGAGGCAGG - Intergenic
988525922 5:31987476-31987498 CATCAGAGGCAGCCTGAGGATGG + Intronic
989425453 5:41290911-41290933 CATGGGAGGGAGACTGAGCAGGG - Intergenic
989520619 5:42396381-42396403 CACAGGAGGGAGGCTGAGGGGGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991143608 5:63274857-63274879 GAGCTGAGGGAGGCTGAGGCAGG + Intergenic
991149109 5:63345438-63345460 CATGGTAGGGCTACTGAGGCAGG - Intergenic
991359342 5:65803336-65803358 CATGGGAGGGAAGCTGAGGGGGG - Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992971614 5:82065368-82065390 AATCCTAGGGAGGCTGAGGCAGG + Intronic
993703390 5:91143867-91143889 CATGGGAGGGAGGCTGAGGGGGG - Intronic
993968990 5:94393958-94393980 CAGCTGAGGGAGGCTGAGACAGG - Intronic
994253014 5:97559081-97559103 CATTTGAGGGAGGCTGAGACTGG + Intergenic
994340129 5:98617261-98617283 CAGCACTGGGAGACTGAGGCAGG + Intergenic
994846369 5:104993422-104993444 TATGGGAGGTAGACTGGGGCTGG + Intergenic
995396625 5:111693875-111693897 CAGCTGAGAGAGGCTGAGGCAGG + Intronic
995827021 5:116312017-116312039 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
996471621 5:123867655-123867677 CATCGTTGGGAGGCCGAGGCGGG - Intergenic
996924344 5:128806518-128806540 GATAGGAGGGAGGCTGAGGTAGG - Intronic
997042851 5:130278109-130278131 TATGGGAGGGAGACTGAGTAGGG - Intergenic
997248945 5:132374106-132374128 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
998073691 5:139218908-139218930 CACAGTTGGGAGACTGAGGCGGG - Intronic
998101825 5:139440744-139440766 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
998108779 5:139485317-139485339 CATCTTTGGGAGGCTGAGGCAGG + Intergenic
998494278 5:142573879-142573901 AATCCCAGGGAGGCTGAGGCAGG - Intergenic
999622913 5:153490571-153490593 CAAGGGAGGGAGAGAGAGGCAGG + Intronic
999737355 5:154522547-154522569 GATTGGTGGGAAACTGAGGCTGG + Intergenic
999973871 5:156891752-156891774 CATCATAGGGAGAATGAGGCTGG - Intergenic
1000018374 5:157298441-157298463 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1000062363 5:157668829-157668851 CATCGATGGGTGACTGAGCCTGG + Intronic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000320570 5:160131297-160131319 GCTAGGAGGGAGGCTGAGGCAGG - Intergenic
1000711969 5:164591501-164591523 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
1001028288 5:168242843-168242865 CTCAGGAGGGAGGCTGAGGCAGG + Intronic
1002344432 5:178537517-178537539 CCTCAGAGGGAGTCTGTGGCAGG + Intronic
1002665695 5:180822654-180822676 CCTTGTAGGGAGACTGGGGCAGG + Intergenic
1002986357 6:2192786-2192808 CCTCCAAGGGAGACTGAGTCAGG - Intronic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003363869 6:5454451-5454473 ACTCGGGGGGAGGCTGAGGCAGG - Intronic
1004119513 6:12806561-12806583 GCTAGGAGGGAGGCTGAGGCAGG - Intronic
1004214142 6:13685817-13685839 AATGGGAGGGAGGCTGAGGTGGG + Intronic
1004955079 6:20720616-20720638 AATCATAGGGAGGCTGAGGCAGG - Intronic
1005685823 6:28252249-28252271 CATAGGAGGGAAGTTGAGGCTGG + Intergenic
1006294597 6:33164522-33164544 CCTCAGAGGGAGACAGAGACGGG + Intronic
1006565200 6:34950336-34950358 TACCTGAGGGAGGCTGAGGCAGG - Intronic
1006670819 6:35728743-35728765 CCTCGGAGGGAGGGAGAGGCAGG + Intergenic
1006849812 6:37090165-37090187 TTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1006926639 6:37659127-37659149 CATTGGAGGATGACTGAGACTGG - Intronic
1006940354 6:37747974-37747996 AATTGGAGGGAAACTGAAGCAGG - Intergenic
1007581523 6:42963004-42963026 GATGGGAGGGAGACTGGTGCTGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008991549 6:57608485-57608507 CTTAGTAGGGAGGCTGAGGCAGG + Intronic
1009180070 6:60506721-60506743 CTTAGTAGGGAGGCTGAGGCAGG + Intergenic
1009243410 6:61205162-61205184 CATGGGAGGGAGACTGAGGGGGG - Intergenic
1009405006 6:63301177-63301199 GTTAGTAGGGAGACTGAGGCAGG + Intronic
1009534347 6:64861193-64861215 CATGGGAGGGAATCTGAGGCAGG - Intronic
1009643139 6:66362968-66362990 TATGGGAGGGAGACTGAAGGGGG - Intergenic
1010212602 6:73373942-73373964 CATCACTGGGAGGCTGAGGCGGG + Intronic
1011477249 6:87760265-87760287 CCTAGTTGGGAGACTGAGGCAGG - Intergenic
1011482154 6:87805780-87805802 GATCCCAGGGAGGCTGAGGCAGG - Intergenic
1011498418 6:87961664-87961686 CATCATAGGGAGACTGTGCCTGG - Intergenic
1012142057 6:95636618-95636640 CATGGGAGGGAGGCTGAGGTAGG - Intergenic
1012545310 6:100412423-100412445 GATACTAGGGAGACTGAGGCAGG + Intronic
1014280308 6:119435487-119435509 CTTCTCAGGGAGGCTGAGGCAGG + Intergenic
1014391632 6:120872248-120872270 CATGGGAGGGAGGCTGAGAAGGG + Intergenic
1014813582 6:125911314-125911336 GGTGGGAGGGAAACTGAGGCAGG - Intronic
1014813768 6:125912761-125912783 GTTGGGAGGGAAACTGAGGCAGG - Intronic
1014935782 6:127383165-127383187 CTTTGCAGGGAGGCTGAGGCAGG + Intergenic
1014969033 6:127791737-127791759 CATGGGAGGGAGGGTGAGGTGGG - Intronic
1014986817 6:128021526-128021548 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1015055897 6:128902768-128902790 GCACTGAGGGAGACTGAGGCAGG - Intronic
1015122714 6:129717677-129717699 CTACTCAGGGAGACTGAGGCAGG - Intergenic
1015663669 6:135603495-135603517 CATAGGAGGAAAGCTGAGGCAGG + Intergenic
1015971325 6:138745549-138745571 TTTGGGAGGGAGGCTGAGGCAGG - Intergenic
1016270949 6:142289846-142289868 TTTGGGAGGGAGGCTGAGGCGGG - Intergenic
1016839711 6:148514000-148514022 CATCGGAGGGAGAGTCCTGCTGG + Intronic
1018255399 6:161913060-161913082 CCTCCCAGGGAGGCTGAGGCAGG + Intronic
1018549614 6:164980683-164980705 CATGGGAGGGACACAGAGGGAGG + Intergenic
1018748965 6:166785326-166785348 CCTAGGGAGGAGACTGAGGCCGG - Intronic
1018998335 6:168726963-168726985 CAGCGTCGGGAGGCTGAGGCAGG - Intergenic
1019117881 6:169779958-169779980 CAGCCGAGGGAGACTGGAGCTGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1020427159 7:8080918-8080940 CATTTTAGGGAGGCTGAGGCGGG - Intronic
1020507809 7:9016720-9016742 GTTAGGAGGGAAACTGAGGCAGG + Intergenic
1021417177 7:20401084-20401106 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1021466751 7:20952743-20952765 CTACTGAGGGAGGCTGAGGCAGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1021899012 7:25264523-25264545 GAAGGGAGTGAGACTGAGGCAGG + Intergenic
1023356476 7:39372025-39372047 CTTGGGAGGGAGGCTGAAGCAGG - Intronic
1023910564 7:44552695-44552717 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
1024265532 7:47603445-47603467 CACCTGCGGGAGGCTGAGGCAGG + Intergenic
1025061249 7:55810584-55810606 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
1025148765 7:56528144-56528166 CATTGGTGGGAGGCTGAGACAGG - Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026047677 7:66918689-66918711 CAACAGTGGGAGGCTGAGGCAGG - Intergenic
1026138214 7:67682019-67682041 CCTAGTAGGGAGGCTGAGGCAGG + Intergenic
1026316269 7:69230413-69230435 CCTCAGTGGGAGACTGAGGTGGG - Intergenic
1026460076 7:70606748-70606770 GATACTAGGGAGACTGAGGCAGG + Intronic
1026921446 7:74158573-74158595 ACTAGGAGGGAGTCTGAGGCAGG - Intergenic
1026977412 7:74506989-74507011 GCTAGGAGGGAAACTGAGGCTGG + Intronic
1027121080 7:75520869-75520891 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1027154164 7:75754681-75754703 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
1027543623 7:79499703-79499725 GTTTGGAGGGAGGCTGAGGCTGG - Intergenic
1027785667 7:82576356-82576378 CTCAAGAGGGAGACTGAGGCGGG - Intergenic
1028111725 7:86949783-86949805 CACAGGAGAGAGACTGAAGCAGG + Intronic
1028136727 7:87230436-87230458 CATGGGAGGGAGGCTGATGGGGG + Intergenic
1028308230 7:89293675-89293697 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1029454324 7:100660535-100660557 CATAGGAGGGATACTGAGATGGG + Intergenic
1030060939 7:105620781-105620803 GCTCGTAGGGAGGCTGAGGCAGG + Intronic
1030091461 7:105862325-105862347 CTTGGGAGGGAGGCTGAGGTGGG + Intronic
1030287778 7:107844440-107844462 TCTACGAGGGAGACTGAGGCAGG - Intergenic
1030359414 7:108579618-108579640 CATGGGAGGGAGGCTGAGGTGGG + Intergenic
1030570240 7:111213325-111213347 CATGGGAGGGAGGCTGAGTGGGG + Intronic
1030587131 7:111434655-111434677 CCTGGGTGGGAGGCTGAGGCAGG - Intronic
1030756294 7:113291487-113291509 CATTGGAGGGAGGCTGATGAGGG + Intergenic
1031018111 7:116597415-116597437 CAGGGAAGGGAGACTGAGGTTGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033325117 7:140371285-140371307 CAGCTGAGGGAGGCTGAGGCAGG - Intronic
1033346846 7:140532155-140532177 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1033370334 7:140701514-140701536 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1033641743 7:143268361-143268383 CCTCAGTGGGAGGCTGAGGCAGG + Intronic
1034206765 7:149323235-149323257 CAGCTGTGGGAGGCTGAGGCAGG - Intergenic
1034609902 7:152356777-152356799 ACCAGGAGGGAGACTGAGGCAGG + Intronic
1034615899 7:152416435-152416457 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1034828726 7:154290528-154290550 AATCTTAGGGAGGCTGAGGCAGG + Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035299144 7:157885853-157885875 CACAGAGGGGAGACTGAGGCAGG - Intronic
1035313395 7:157983603-157983625 CCTGGGAGTGAGTCTGAGGCAGG + Intronic
1035796288 8:2360299-2360321 CTCGGGAGGGAGGCTGAGGCAGG - Intergenic
1036548204 8:9792430-9792452 CAGCTGAAGGAGGCTGAGGCAGG + Intergenic
1036743619 8:11388925-11388947 GATCTCAGGGAGCCTGAGGCAGG - Intergenic
1036810612 8:11865905-11865927 CTTGGGAGGGAGGCTGAGACAGG + Intronic
1037484424 8:19334044-19334066 ACTCGGAGGGAAACTGAGGCAGG + Intronic
1038290148 8:26241932-26241954 CCTGGGAGGGAGGCTGAGGTGGG + Intergenic
1038531595 8:28322140-28322162 CACCTTAGGGAGGCTGAGGCGGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038748918 8:30278341-30278363 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1038785620 8:30612636-30612658 CAGGAGAGGGAGGCTGAGGCAGG - Intronic
1039479049 8:37858280-37858302 CATTGTAGAGAGACAGAGGCAGG - Intergenic
1039541692 8:38377593-38377615 TTTGGGAGGGAGGCTGAGGCGGG - Intronic
1040026811 8:42789203-42789225 CTACTCAGGGAGACTGAGGCAGG - Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040111459 8:43568781-43568803 CTTCAGGGGGAGATTGAGGCAGG - Intergenic
1040111932 8:43570519-43570541 CTTCGCAGGGAGGTTGAGGCAGG - Intergenic
1040311845 8:46240854-46240876 ACTCAGAGGGACACTGAGGCAGG + Intergenic
1040319829 8:46286911-46286933 CCTCAGAGGGACATTGAGGCAGG - Intergenic
1040325355 8:46338816-46338838 CCTCAGTGGGACACTGAGGCAGG + Intergenic
1040443164 8:47465622-47465644 CTACTGAGGGAGGCTGAGGCAGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041688560 8:60667261-60667283 CTTGGGAGGGGAACTGAGGCTGG - Intergenic
1042228282 8:66532327-66532349 AATCCCAGGGAGGCTGAGGCAGG - Intergenic
1043455820 8:80411164-80411186 CATACGTGGGAGGCTGAGGCAGG - Intergenic
1043750355 8:83926616-83926638 CATGGGAGGGAGGCTGAAGGGGG - Intergenic
1044091227 8:88004338-88004360 AATTGAAGGGAGGCTGAGGCAGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046414950 8:113901185-113901207 ACTCGGGGGGAGGCTGAGGCAGG - Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046674710 8:117094839-117094861 CATGGGAAGGAGGCTGAGGTGGG - Intronic
1048081976 8:131138297-131138319 CTCGGGAGGGAGGCTGAGGCGGG + Intergenic
1048548003 8:135404939-135404961 CATGGGAGGGAGGCTGAGTGGGG - Intergenic
1048703951 8:137128606-137128628 CTCAGGAGGGAGGCTGAGGCAGG + Intergenic
1048854977 8:138679025-138679047 CTATGGAGGGAGGCTGAGGCAGG - Intronic
1049010127 8:139881920-139881942 CATCAGAGGGAGGCCCAGGCAGG - Intronic
1049107066 8:140620741-140620763 CATCTGTGGGAGGCTGAGGCAGG + Intronic
1049470955 8:142774792-142774814 CACCAGGGGCAGACTGAGGCAGG + Intronic
1049614253 8:143569264-143569286 CCTGGGAGGGAGACTGGGGGCGG + Intronic
1050527951 9:6562669-6562691 CTACTGAGGGAGGCTGAGGCAGG - Intronic
1050550989 9:6748052-6748074 CCTATGAGGGAGGCTGAGGCAGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051028612 9:12646678-12646700 AATTTGAGGGAGGCTGAGGCAGG + Intergenic
1052318275 9:27139099-27139121 CTCCGGAGGGAGGCTGAGGCAGG + Intronic
1052405776 9:28059081-28059103 GTTGGGAGGGAAACTGAGGCAGG + Intronic
1052538268 9:29775878-29775900 GTTGGGAGGGAAACTGAGGCAGG - Intergenic
1052552596 9:29970025-29970047 CATGGGAGGGAGACCGAAGGTGG - Intergenic
1053202437 9:36161936-36161958 CAGCACTGGGAGACTGAGGCAGG + Intronic
1053301137 9:36950476-36950498 CTTGGGAGGAAGACTGAGGAGGG - Intronic
1053381132 9:37650670-37650692 CCCAGGGGGGAGACTGAGGCTGG - Intronic
1054257980 9:62834072-62834094 CAGCAGAGGAAGACTGGGGCAGG - Intergenic
1056517888 9:87372142-87372164 AATCCCAGGGAGACTGAGGTGGG + Intergenic
1056716449 9:89034859-89034881 GTTGGGAGGGAAACTGAGGCAGG + Intronic
1057510864 9:95678613-95678635 CATGGGAGGGAGGCTGAGCAGGG - Intergenic
1058386698 9:104444809-104444831 CATAGGAGAGAGATGGAGGCTGG - Intergenic
1060299036 9:122363274-122363296 CAGCTCAGGGAGGCTGAGGCGGG - Intergenic
1060644384 9:125265520-125265542 CCCAGGAGGGAGACTGAGGCAGG - Intronic
1060668372 9:125447220-125447242 CATCTGAGGAAGAGTGAAGCAGG + Intronic
1060991393 9:127851464-127851486 TTTGGGAGGGAGGCTGAGGCGGG - Intronic
1061017482 9:127990323-127990345 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1061065607 9:128275840-128275862 CATCGGAGTGGGGCTGGGGCTGG + Intronic
1061471323 9:130828309-130828331 CTTTGGGGGGAGGCTGAGGCAGG - Intronic
1061585256 9:131563008-131563030 AAAGGGAGGGAGGCTGAGGCCGG - Intergenic
1061853242 9:133428423-133428445 CTTCTGGGGGAAACTGAGGCAGG + Intronic
1062218210 9:135400372-135400394 ATTGGGAGGGAAACTGAGGCAGG - Intergenic
1062676034 9:137744564-137744586 CAACACTGGGAGACTGAGGCGGG - Intronic
1202800793 9_KI270719v1_random:174308-174330 CAGCAGAGGAAGACTGGGGCAGG + Intergenic
1185864828 X:3614252-3614274 CTTCTTTGGGAGACTGAGGCTGG + Intronic
1185965473 X:4596136-4596158 TACAGGAGGGAGGCTGAGGCTGG - Intergenic
1186851443 X:13583901-13583923 CATGGCAGGGATACTAAGGCAGG + Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188931621 X:36118579-36118601 CTCAGGAGGGAGGCTGAGGCAGG - Intronic
1188953172 X:36401879-36401901 CTTAGCTGGGAGACTGAGGCAGG - Intergenic
1189158756 X:38788290-38788312 CTTACTAGGGAGACTGAGGCAGG + Intergenic
1189375567 X:40463966-40463988 CTTGGGTGGGAGGCTGAGGCAGG - Intergenic
1189773349 X:44447791-44447813 CATGGTTGGGAGGCTGAGGCAGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190112637 X:47604261-47604283 AATAGGAGGGAGGCTGAGGTGGG + Intronic
1190805636 X:53833629-53833651 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1191016318 X:55813627-55813649 CATGGAAGGGAGGCTGAGGGGGG + Intergenic
1191769186 X:64737514-64737536 CATGGGAGAAAGATTGAGGCTGG + Intergenic
1192267170 X:69546859-69546881 CACAGGAGGGAGGCTGAGGGGGG + Intergenic
1192432830 X:71124307-71124329 CATCAAAGGGAGAGGGAGGCCGG - Exonic
1192816676 X:74600910-74600932 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1192822508 X:74659372-74659394 GTTGGGAGGGAAACTGAGGCAGG - Intergenic
1193233256 X:79074230-79074252 GCTCTGAGGGAGGCTGAGGCAGG + Intergenic
1193237812 X:79130573-79130595 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
1194756441 X:97744171-97744193 CATGGGAGGGACACTGTGGAAGG + Intergenic
1195486845 X:105418372-105418394 AAAAGGAGTGAGACTGAGGCAGG - Intronic
1196824172 X:119728013-119728035 CTTAGTTGGGAGACTGAGGCAGG - Intergenic
1198101500 X:133426155-133426177 CTTGGGAGGGAGACTGAGGTGGG - Intergenic
1198189445 X:134287909-134287931 CATGGGAGGGAGGCAGAGGGGGG + Intergenic
1198203607 X:134445684-134445706 CATAGTTGGGAGGCTGAGGCAGG + Intergenic
1199987214 X:152961388-152961410 GACCAGAGGGAAACTGAGGCTGG - Intronic
1200234545 X:154461949-154461971 CTGCGGAGGGAGACAGAGGAGGG - Intronic
1201165445 Y:11204634-11204656 CACAGGAGGGAGGCTGAGGTGGG + Intergenic
1201374753 Y:13306810-13306832 CATCGGAGGGAGACTGAGGCAGG - Intronic
1202366303 Y:24168300-24168322 CATCGGAGGGGATCTGTGGCTGG - Intergenic
1202504478 Y:25501823-25501845 CATCGGAGGGGATCTGTGGCTGG + Intergenic