ID: 1201376047

View in Genome Browser
Species Human (GRCh38)
Location Y:13320972-13320994
Sequence TAGGAGCCCCAATATTATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 48, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201376043_1201376047 14 Left 1201376043 Y:13320935-13320957 CCTGTGGTAAGTAAAGAATGTCA 0: 162
1: 262
2: 244
3: 129
4: 193
Right 1201376047 Y:13320972-13320994 TAGGAGCCCCAATATTATCTTGG 0: 1
1: 0
2: 0
3: 48
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201376047 Original CRISPR TAGGAGCCCCAATATTATCT TGG Intronic
902971136 1:20051853-20051875 CAGGAGCCCCAAGTTTATCTTGG + Intronic
904709725 1:32420707-32420729 CAGGAGCTCCAAGTTTATCTTGG + Intergenic
907042859 1:51279007-51279029 TAGGAGCAACAATACCATCTAGG - Intergenic
908018068 1:59867416-59867438 AAGGAGCCACAATAGTATTTTGG + Intronic
909736537 1:78969450-78969472 CAGGAGCTCCAAGTTTATCTTGG + Intronic
912111357 1:106346595-106346617 TAGGAGCTCCAGGTTTATCTCGG - Intergenic
913103352 1:115590733-115590755 CAGGAGCTCCAAGTTTATCTTGG + Intergenic
915672545 1:157502590-157502612 TAGGAGCTCCAAGTTTATCTTGG + Intergenic
916623865 1:166532247-166532269 CAGGAGCCCCACGTTTATCTTGG + Intergenic
917077019 1:171215976-171215998 TAGGAGCTCCAAGTTTATCTTGG - Intergenic
917209684 1:172619145-172619167 TAGGAGCTCCAAGTTAATCTTGG + Intergenic
917310824 1:173675990-173676012 CAAGAGCCCCAAGTTTATCTTGG - Intergenic
917371577 1:174299290-174299312 CAGGAGCTCCAAGTTTATCTTGG - Intronic
917893866 1:179466976-179466998 TAGGGGTCCCAATAGTATCCTGG + Intronic
918252469 1:182715634-182715656 GAGCAGCATCAATATTATCTGGG - Intergenic
921451605 1:215314858-215314880 TAGAAGCCCAAATATATTCTAGG + Intergenic
923914109 1:238483215-238483237 CAGGAGCTCCAAGTTTATCTTGG - Intergenic
924929550 1:248716757-248716779 CAGGAGCCCCAAGTTTATCTTGG + Intergenic
1063341127 10:5263956-5263978 CAGGAGCCCCAAGTTTATCTTGG - Intergenic
1063582735 10:7323545-7323567 AAGGAGCCCCAATATTACATGGG + Intronic
1065151582 10:22827848-22827870 CAGGAGCTCCAAGTTTATCTTGG - Intergenic
1068496916 10:57794635-57794657 CAGGAGCTCCAAGTTTATCTTGG + Intergenic
1068808963 10:61234117-61234139 CAGAAGCCCCAAGTTTATCTTGG + Intergenic
1068907322 10:62341257-62341279 CAGGAGCCCCCAAGTTATCTTGG - Intergenic
1071012531 10:80954847-80954869 TAGGAGCTCCAAGTTTATCTTGG - Intergenic
1071689544 10:87802361-87802383 CAGGAGCCCCAAGTTTATCTTGG + Intronic
1071898462 10:90091407-90091429 CAGAAGCCCCAAGTTTATCTTGG + Intergenic
1071926341 10:90414424-90414446 CAGGAGCTCCAAGTTTATCTTGG + Intergenic
1073574478 10:104611023-104611045 TAGGAGCTCCAATTTTACCTTGG + Intergenic
1074217374 10:111398967-111398989 TCGGAGTCCCAATTTTGTCTAGG - Intergenic
1077534640 11:3117321-3117343 CAGGAGCTCCAAATTTATCTTGG + Intronic
1080917144 11:36671667-36671689 CAGGAGCTCCAAGTTTATCTTGG + Intergenic
1081295200 11:41377966-41377988 AAGGAGCCTCAATATTAACCCGG - Intronic
1082951983 11:58827124-58827146 CAGGAGCCCCAAGTATATCTTGG + Intergenic
1083239424 11:61375890-61375912 CAGGAGTCCCAAGTTTATCTTGG + Intergenic
1083358867 11:62091063-62091085 TAGGAGCCCCAAATTTGTATTGG + Intergenic
1085720491 11:78908117-78908139 AAGGAGCCTCACTATGATCTTGG - Intronic
1086052862 11:82614654-82614676 TAAGAGCCCCAAGGTTCTCTTGG - Intergenic
1086296258 11:85371707-85371729 TAGGAGCTCCAAGTTTATCTTGG + Intronic
1086962109 11:92988618-92988640 TAGGACTTCCAGTATTATCTTGG - Intergenic
1087486096 11:98761574-98761596 TAGGAGCTCCAAGTTTATCTTGG + Intergenic
1088454156 11:110016014-110016036 TAGGATCCCTAATATTATACAGG - Intergenic
1089522792 11:119076726-119076748 TAGTAGCACCGATATTACCTGGG + Intronic
1090100368 11:123789166-123789188 CTGGAGCCCCAAGTTTATCTTGG - Intergenic
1092383924 12:8020976-8020998 GAGAAGCCCAAAAATTATCTTGG + Intergenic
1092563300 12:9638728-9638750 CAGGAGCTCCAAGTTTATCTTGG - Intergenic
1094363228 12:29652331-29652353 ATGGAACCCCAATATCATCTTGG - Intronic
1095268576 12:40188796-40188818 CAGGAGCCCTAAGTTTATCTTGG - Intergenic
1095855477 12:46855580-46855602 CAGGATCCCCAAGTTTATCTTGG - Intergenic
1098436268 12:70471217-70471239 CAGGAGCTCCAAGTTTATCTTGG + Intergenic
1098805704 12:75017801-75017823 CAGGAGCTCCAAATTTATCTTGG - Intergenic
1099535084 12:83833467-83833489 CAGGAGCTCCAAGTTTATCTTGG - Intergenic
1100190321 12:92183897-92183919 TAGCAGCCAAAATATTATATAGG + Intergenic
1100206956 12:92360622-92360644 GAGGAGGCCCAACATTTTCTGGG - Intergenic
1101383180 12:104232235-104232257 CAGGAGCTCCAAGTTTATCTTGG - Intronic
1105614359 13:21998897-21998919 TAGGAGGGCCCACATTATCTTGG + Intergenic
1108203997 13:48070239-48070261 CAGGAGCTCCAAGTTTATCTTGG + Intronic
1108509626 13:51144716-51144738 TAGAAGCCCCAGATTTATCTTGG + Intergenic
1108893241 13:55290076-55290098 TATGAGCACCAATTTTATGTTGG + Intergenic
1109012834 13:56973119-56973141 TAGGAGTTCCAAGTTTATCTTGG + Intergenic
1109745247 13:66616150-66616172 TAGGAGCTCTAAGTTTATCTTGG + Intronic
1109865581 13:68259591-68259613 CAGGAGCTCCAAGTTTATCTTGG + Intergenic
1110256960 13:73443471-73443493 TAGGAGCTCCAGGTTTATCTTGG + Intergenic
1110567898 13:76974646-76974668 AAGGAGCCCCAGTACTAGCTGGG - Intergenic
1112876157 13:104041852-104041874 AAAGAGCCCCAACATTATATTGG - Intergenic
1118510781 14:66470744-66470766 CAGGAGCCCCAGGTTTATCTCGG + Intergenic
1118631466 14:67707802-67707824 CAGGAGCCCCAAGTTTACCTTGG - Intronic
1118938769 14:70313262-70313284 CAGGAGCCCCAAGTTTATCTTGG + Intergenic
1120314172 14:82870965-82870987 TAGGAGCTCCAAGTTTATCTTGG + Intergenic
1202920929 14_KI270723v1_random:29960-29982 CAGGAACCCCAATACTATCTGGG - Intergenic
1202923986 14_KI270724v1_random:7621-7643 CAGGAACCCCAATACTATCTGGG + Intergenic
1123766093 15:23479779-23479801 CAGGAGCACCAAGTTTATCTTGG + Intergenic
1127959813 15:63882450-63882472 TCTGAGCCCCAATATTTGCTTGG + Intergenic
1128571272 15:68734947-68734969 TGGGAGCTCCAACATTAACTGGG - Intergenic
1136352072 16:29717121-29717143 TGGGAGCTCCAAGTTTATCTTGG + Intergenic
1138701328 16:58866629-58866651 TAGGAGCACCAAGAATGTCTGGG + Intergenic
1139305989 16:65986840-65986862 TCTGAGCCCCAACATGATCTGGG + Intergenic
1140459526 16:75128214-75128236 CAGGAGCCCCACGTTTATCTTGG + Intergenic
1141404050 16:83775906-83775928 TAGAAGCCCCTATATTTCCTGGG + Intronic
1143888052 17:10080647-10080669 TAGGAAGCCCAATATTACCAAGG + Intronic
1146039295 17:29435551-29435573 TAGGAGCTCCAAGTTTATCTTGG - Intronic
1146441488 17:32899368-32899390 CAGGAGCCCCAAGTTTATCTTGG - Intergenic
1147513376 17:41093490-41093512 CAGGAGCCCCAAGTTTATCTTGG + Intronic
1147515468 17:41113785-41113807 CAGGAGCCCCAAGTTTATCTTGG + Intergenic
1149094633 17:52825733-52825755 TAGGAGCTCCCAGTTTATCTTGG - Intergenic
1149472669 17:56931372-56931394 CAGGAGCACCAAGTTTATCTTGG + Intergenic
1149820047 17:59767756-59767778 TAGGATCCTAAATATTATTTGGG - Intronic
1155784703 18:29881672-29881694 TAGGAGCTCCAAGTTTATCTTGG - Intergenic
1156698642 18:39797265-39797287 TAGGAGCTCCAAGTTTATCTTGG - Intergenic
1157661753 18:49451496-49451518 CAGGAGCTCCAAGTTTATCTTGG + Intronic
1157821960 18:50778514-50778536 TAGGAGCTCCAAGTTTATCTTGG + Intergenic
1158152036 18:54384196-54384218 TAGGAGCTCCAAGTTTATCTTGG - Intronic
1164211812 19:23104866-23104888 TAGGAGCTCCAAGTTTGTCTTGG + Intronic
925471780 2:4170152-4170174 CAGGAGCTCCAAGTTTATCTTGG - Intergenic
927227389 2:20782132-20782154 CAGCAGCACCAATATTACCTGGG + Intronic
929133234 2:38599167-38599189 TAGGAGCAACAATTTTATCTTGG + Intronic
930495042 2:52130676-52130698 CAGGAGGCCCAAATTTATCTTGG + Intergenic
930962473 2:57277636-57277658 TGGCAGCCCAAATAGTATCTTGG - Intergenic
933131117 2:78674917-78674939 CAGGAGCTCCAAATTTATCTTGG - Intergenic
934108489 2:88718499-88718521 TAGGAGGCCCAAGTTTATCTTGG - Intronic
935024847 2:99266947-99266969 CAGGAGCCCCAGGTTTATCTTGG + Intronic
935153273 2:100459279-100459301 CAGGAGCCCCAAGTTTATCTTGG + Intergenic
935331978 2:101983977-101983999 TAGGGGCACCAATAATATTTTGG - Intergenic
936278543 2:111120021-111120043 TAGGACCCCCAAGATTTGCTGGG - Intronic
936478391 2:112862239-112862261 CAGGAGCCCAAAGTTTATCTTGG + Intergenic
939339549 2:140876635-140876657 CAGGAGCTCCAAGTTTATCTTGG + Intronic
940987949 2:160067290-160067312 CAGGAGCTCCAAGTTTATCTTGG - Intergenic
941811070 2:169756615-169756637 CAGCAGCACCAATCTTATCTGGG - Intronic
943598165 2:189882105-189882127 CAGGAGCCCCAAGTTTATCTTGG - Intronic
947287849 2:228537437-228537459 CAGGAGCCTCAAGTTTATCTTGG + Intergenic
948256880 2:236574852-236574874 GAGGAGCCCCAGTACCATCTGGG + Intronic
949029091 2:241780806-241780828 CAGGAGCCCCAAGTTTATCTTGG - Intronic
1169572909 20:6926022-6926044 TGGGAGGCATAATATTATCTGGG - Intergenic
1171989664 20:31686080-31686102 TAGGAGCCCAAATAGCCTCTGGG + Intronic
1174231870 20:49052102-49052124 TAGCAGCCCCAACATAATGTGGG - Intronic
1178619733 21:34163113-34163135 TAGGAGCTCCAAGTTTATCTTGG - Intergenic
1183168782 22:36168608-36168630 TAGGAACCCCCAAGTTATCTTGG - Intergenic
950919124 3:16676438-16676460 CAGGAGCCCCAAGTTTATCCTGG + Intergenic
951297989 3:20962784-20962806 CAGGAGCCCCAAGTTTATCTCGG + Intergenic
951345765 3:21545828-21545850 TAGGAACTCCAAGTTTATCTTGG + Intronic
951866005 3:27308401-27308423 TCCTAGCTCCAATATTATCTTGG + Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG + Intronic
958744143 3:98112748-98112770 TAGGAGCTCCAAGTTTATTTTGG + Intergenic
959275663 3:104274312-104274334 CAGGAGCTCCAAGTTTATCTTGG - Intergenic
959970337 3:112401905-112401927 CAGGAGCCCCAGGTTTATCTTGG - Intergenic
963034348 3:141012669-141012691 CTGGAGCTCCAATATCATCTTGG - Intergenic
965114341 3:164468664-164468686 CAGGAGCCCCATATTTATCTTGG + Intergenic
967130535 3:186466371-186466393 GAAAAGCCCCAATTTTATCTGGG - Intergenic
967244837 3:187476105-187476127 CAGGAGCCCCAAATTTATCTTGG + Intergenic
968294666 3:197566404-197566426 CAGGAGCCCCAAGTTTATCTTGG + Intronic
969512161 4:7624472-7624494 CAGCAGCCACAATACTATCTTGG + Intronic
970717194 4:18940189-18940211 TGGGTGCACCAATATTATCATGG + Intergenic
971913281 4:32824532-32824554 CAGGAGCCCCAAGTTCATCTTGG - Intergenic
972159206 4:36202130-36202152 AACGAGACCCAATATTTTCTAGG + Intronic
973245424 4:48005620-48005642 CAGGAGCCCCAGGTTTATCTTGG - Intronic
974181833 4:58394138-58394160 TAAAATCCCCAATATTATTTTGG - Intergenic
974948467 4:68557931-68557953 CAGGAGCCCCAAGTTTATTTTGG + Intronic
974957491 4:68660331-68660353 CAGGAGCCCCAAGTTTATTTTGG + Intronic
977042538 4:92032039-92032061 CAGGAGCCCCAGGTTTATCTTGG - Intergenic
977354801 4:95932175-95932197 CAGCAGCCCCAAATTTATCTAGG + Intergenic
978328770 4:107588378-107588400 CAGGAGCTCCAAGTTTATCTTGG - Intergenic
980071556 4:128247783-128247805 CAGGAGCCCCAAGTTTATCTCGG - Intergenic
982477840 4:155874386-155874408 CAGGAGCTCCAAGTTTATCTTGG - Intronic
983321454 4:166201317-166201339 CAGGAGCTCCAAGTTTATCTTGG + Intergenic
985450309 4:190058204-190058226 TGGGAACCCCAATACTATCCGGG - Intergenic
986213594 5:5697544-5697566 TAGGAGCTCCAAGTTTATCTTGG + Intergenic
987943062 5:24567190-24567212 TAACAACACCAATATTATCTAGG + Intronic
988899797 5:35719579-35719601 CAGGAGCTCCAACTTTATCTTGG - Intronic
989715355 5:44455914-44455936 CAGGAGCTCCAAGTTTATCTTGG - Intergenic
992292890 5:75298424-75298446 CAGGAGCCCCAAGTTTATCTTGG + Intergenic
995393680 5:111665173-111665195 TAGGAGCTTCAAGTTTATCTTGG - Intronic
996574371 5:124965687-124965709 CAGGAGCTCCAAGTTTATCTTGG + Intergenic
1000686683 5:164258431-164258453 TAGGATTCTCAAAATTATCTAGG + Intergenic
1006327452 6:33365118-33365140 CAGGAGACACAAGATTATCTGGG + Intergenic
1010866367 6:80980796-80980818 TAGAAGACACAATATTCTCTTGG - Intergenic
1012583599 6:100897212-100897234 CAGGAGCTCCAAGTTTATCTTGG + Intergenic
1013075539 6:106767670-106767692 TAGAGTCCCCAATATTTTCTGGG + Intergenic
1014865925 6:126530044-126530066 TTTGAACCCCAATATGATCTGGG - Intergenic
1018138192 6:160799148-160799170 CAGGAGCCCCCAAGTTATCTTGG + Intergenic
1018179833 6:161213097-161213119 CAGGAGCCTCAAGTTTATCTTGG + Intronic
1019123100 6:169820770-169820792 CAGGAGCCCCAAGTTTATCTTGG + Intergenic
1019232727 6:170582193-170582215 GAGGAGCCCAAATAATATCTGGG - Intronic
1019233544 6:170588721-170588743 CAGGAGCCTCAAGTTTATCTTGG - Intergenic
1020555615 7:9665690-9665712 TAGGAGCTCCAAGTTTACCTTGG - Intergenic
1020677065 7:11195699-11195721 TAGGAGCTCCCAGTTTATCTTGG + Intergenic
1021147824 7:17110762-17110784 CAGGAGACCCAAGTTTATCTTGG + Intergenic
1025157663 7:56623877-56623899 CAGGAGCTCCAAGGTTATCTTGG + Intergenic
1025758092 7:64364168-64364190 CAGGAGCCCCAAGTTTATCTTGG - Intergenic
1030245614 7:107382205-107382227 CAGGAGCTCCAAGTTTATCTTGG + Intronic
1031227286 7:119055745-119055767 CAGGAGCCTCAAGGTTATCTTGG - Intergenic
1031475719 7:122218707-122218729 TGGGACCCACAAAATTATCTGGG - Intergenic
1032132006 7:129237602-129237624 TTGGAGCCCCAATGATATCTCGG + Intronic
1033161873 7:139004863-139004885 CAGGAGCCCCCAGGTTATCTTGG + Intergenic
1037111333 8:15167420-15167442 TAGGAGCTCCAAGTTCATCTTGG + Intronic
1040990611 8:53346074-53346096 TAGGAGCTCCAAGTTTGTCTTGG + Intergenic
1041650901 8:60301396-60301418 TAGAAGCCCCAGGTTTATCTTGG - Intergenic
1046068252 8:109221327-109221349 CAGGAGCTCCAAGTTTATCTTGG + Intergenic
1047710664 8:127548927-127548949 GATGAGCCCCCATATTTTCTAGG + Intergenic
1050376291 9:4976933-4976955 TGGGAGCCCCAGTTTTATCAGGG - Intergenic
1053075749 9:35132931-35132953 AGGGAGCCCCAAGTTTATCTTGG + Intergenic
1053082424 9:35187761-35187783 CAGGAGCTCCAAGTTTATCTTGG - Intronic
1055051451 9:71985423-71985445 TAGCAGCATCAATATTACCTGGG + Intronic
1057467183 9:95324966-95324988 CAGGAGCCCCAAGTCTATCTTGG - Intergenic
1057482087 9:95452880-95452902 TAGGTGGCCCATTATTGTCTCGG - Intronic
1058112672 9:101048245-101048267 CAGGAGCCCCAGTGTTTTCTTGG - Intronic
1058217632 9:102254710-102254732 TATCAGCCCCAATTTCATCTGGG - Intergenic
1058997283 9:110312509-110312531 CAGGAGCCCCAAGTTTATCATGG + Intronic
1059734505 9:117087873-117087895 TAGAAGCCCCATTATTTTCTGGG + Intronic
1186705346 X:12134759-12134781 TAGGAGGCCCAACATTCGCTTGG - Intergenic
1187817260 X:23246251-23246273 CAGGAGCCCCAAGTTTATGTTGG + Intergenic
1188159204 X:26779697-26779719 CAGGAGCTCCAAGTTTATCTTGG - Intergenic
1188763090 X:34056449-34056471 CAGGAGCTCCAACTTTATCTCGG + Intergenic
1188862577 X:35274158-35274180 TAGGAGCTCCAAACTTATCTTGG - Intergenic
1189153223 X:38728969-38728991 TAGGAGCTCCAAGTTTATCTTGG + Intergenic
1189616661 X:42790821-42790843 CAGGAGCTCCAAGTTTATCTTGG - Intergenic
1190431711 X:50384379-50384401 TAGAACCCTTAATATTATCTAGG - Intronic
1190549061 X:51559941-51559963 CAGGAGCTCCAAGTTTATCTTGG - Intergenic
1191644817 X:63468583-63468605 TAGCAGCTCCAAGTTTATCTTGG - Intergenic
1191740423 X:64432070-64432092 CAGGAGCCCCAGGTTTATCTTGG + Intergenic
1191757795 X:64613140-64613162 TAGAAGCCCGTAGATTATCTTGG - Intergenic
1192681276 X:73256126-73256148 TAGGAGCTCCAAATTTATCTTGG - Intergenic
1193269594 X:79514022-79514044 AAGGAGCTCCAAGTTTATCTTGG + Intergenic
1194027338 X:88769557-88769579 TAGGAGCTCCAAGTTTATCTTGG + Intergenic
1194066526 X:89268269-89268291 TAGGAGCTCCAAGTTTATCTTGG - Intergenic
1194402860 X:93459657-93459679 CAGGAGCTCCAAGGTTATCTTGG - Intergenic
1195150618 X:102065855-102065877 CAGGAGCCCCAGATTTATCTTGG + Intergenic
1195225633 X:102789705-102789727 CAGGAGCCCCAAGTTTATCTTGG - Intergenic
1196773059 X:119315030-119315052 CAGGAGCCCTAAGTTTATCTTGG + Intergenic
1196854465 X:119969975-119969997 TAGTGGCCCTAATTTTATCTGGG + Intergenic
1197043089 X:121963858-121963880 CAGGAGCCCTAAGTTTATCTTGG + Intergenic
1197452591 X:126638629-126638651 TAGGAGCCCTATTAATATGTTGG + Intergenic
1199169616 X:144720768-144720790 CAGGAGCTCCAAGTTTATCTTGG + Intergenic
1199869555 X:151885933-151885955 CAGAAGCCCCAAGTTTATCTTGG + Intergenic
1199887253 X:152032525-152032547 CAGGAGCCCCAAATTTATCTTGG - Intergenic
1200720694 Y:6602390-6602412 TAGGAGCTCCAAGTTTATCTTGG - Intergenic
1201319901 Y:12686942-12686964 CAGAAGCCCCAAGTTTATCTTGG + Intergenic
1201376047 Y:13320972-13320994 TAGGAGCCCCAATATTATCTTGG + Intronic
1201864612 Y:18636434-18636456 TTGGAGCTCCAAATTTATCTGGG + Intergenic
1201868710 Y:18683944-18683966 TTGGAGCTCCAAATTTATCTGGG - Intergenic
1202259187 Y:22951765-22951787 CAGGAGCTCCAAGTTTATCTTGG - Intergenic
1202412173 Y:24585509-24585531 CAGGAGCTCCAAGTTTATCTTGG - Intergenic
1202458607 Y:25084559-25084581 CAGGAGCTCCAAGTTTATCTTGG + Intergenic