ID: 1201376662

View in Genome Browser
Species Human (GRCh38)
Location Y:13330374-13330396
Sequence GAGGGCAAACAGAAGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2287
Summary {0: 6, 1: 75, 2: 308, 3: 635, 4: 1263}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201376651_1201376662 24 Left 1201376651 Y:13330327-13330349 CCCAGTTTATCTCACTGGGACTG 0: 5
1: 103
2: 652
3: 1081
4: 1328
Right 1201376662 Y:13330374-13330396 GAGGGCAAACAGAAGCAGGGTGG 0: 6
1: 75
2: 308
3: 635
4: 1263
1201376652_1201376662 23 Left 1201376652 Y:13330328-13330350 CCAGTTTATCTCACTGGGACTGG 0: 6
1: 137
2: 371
3: 450
4: 458
Right 1201376662 Y:13330374-13330396 GAGGGCAAACAGAAGCAGGGTGG 0: 6
1: 75
2: 308
3: 635
4: 1263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201376662 Original CRISPR GAGGGCAAACAGAAGCAGGG TGG Intronic
Too many off-targets to display for this crispr