ID: 1201383535

View in Genome Browser
Species Human (GRCh38)
Location Y:13413330-13413352
Sequence CGGTGTGGATAGAGGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 299}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201383535_1201383550 17 Left 1201383535 Y:13413330-13413352 CCTCCTGCCCTCTATCCACACCG 0: 1
1: 0
2: 0
3: 24
4: 299
Right 1201383550 Y:13413370-13413392 ACAGGAAGCAGCAGGGTGCCAGG 0: 1
1: 0
2: 4
3: 101
4: 534
1201383535_1201383547 9 Left 1201383535 Y:13413330-13413352 CCTCCTGCCCTCTATCCACACCG 0: 1
1: 0
2: 0
3: 24
4: 299
Right 1201383547 Y:13413362-13413384 CCCATGTGACAGGAAGCAGCAGG 0: 1
1: 0
2: 5
3: 26
4: 238
1201383535_1201383551 27 Left 1201383535 Y:13413330-13413352 CCTCCTGCCCTCTATCCACACCG 0: 1
1: 0
2: 0
3: 24
4: 299
Right 1201383551 Y:13413380-13413402 GCAGGGTGCCAGGCCAGCCCAGG 0: 1
1: 1
2: 2
3: 78
4: 556
1201383535_1201383549 10 Left 1201383535 Y:13413330-13413352 CCTCCTGCCCTCTATCCACACCG 0: 1
1: 0
2: 0
3: 24
4: 299
Right 1201383549 Y:13413363-13413385 CCATGTGACAGGAAGCAGCAGGG 0: 1
1: 0
2: 3
3: 33
4: 339
1201383535_1201383544 -1 Left 1201383535 Y:13413330-13413352 CCTCCTGCCCTCTATCCACACCG 0: 1
1: 0
2: 0
3: 24
4: 299
Right 1201383544 Y:13413352-13413374 GGGTGGCTGCCCCATGTGACAGG 0: 1
1: 3
2: 5
3: 35
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201383535 Original CRISPR CGGTGTGGATAGAGGGCAGG AGG (reversed) Intronic
900345824 1:2209838-2209860 CTGTCTGGACAGAAGGCAGGAGG - Intronic
900596725 1:3483359-3483381 CTGTGTGGATGCAGGGCAGTGGG + Intergenic
900806941 1:4773766-4773788 CCGTGTGGGTAGAGGGCAGAGGG + Intronic
903018898 1:20379891-20379913 GGGTGGGGAAAGAGGGCAGGTGG - Intergenic
903331097 1:22597633-22597655 AGGTGTGGAGGGAGGGCAGTGGG - Intronic
903781223 1:25821031-25821053 CAGTGTGGCTGGAGGGCAAGGGG + Intronic
903844711 1:26271954-26271976 CGGTGAGGACAGAGGGCAAGGGG - Intronic
904383334 1:30125784-30125806 AGGTGGGGAGAGAGGGGAGGGGG + Intergenic
904441676 1:30535821-30535843 CTGTGTGGTTGGAGGGCAGGGGG + Intergenic
906484820 1:46226160-46226182 CAGGGTGGAAAGTGGGCAGGAGG + Intergenic
909942533 1:81626919-81626941 GGGTGTGGGTGGAGGGTAGGTGG + Intronic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
915732749 1:158065834-158065856 CTGAGGGGAAAGAGGGCAGGCGG - Intronic
916501194 1:165388632-165388654 CGATGGGGAAGGAGGGCAGGAGG + Intergenic
919816385 1:201443413-201443435 AGGTGTGGATAGAGAGAAGCTGG + Intergenic
921539877 1:216399897-216399919 AGGTGTGCACAGAGGCCAGGTGG - Intronic
922727156 1:227927859-227927881 GGGTGTGGACAGGGGACAGGGGG + Intronic
1063377946 10:5565333-5565355 CGGTGTGAGTATTGGGCAGGAGG + Intergenic
1064885356 10:20105639-20105661 AGGTGGGGGTAGGGGGCAGGAGG - Intronic
1065497975 10:26349595-26349617 CGGTGAGAACAGCGGGCAGGAGG + Intergenic
1067168719 10:43886166-43886188 GAGTGTGGGCAGAGGGCAGGTGG + Intergenic
1067761094 10:49047710-49047732 TGGAGTGGAAAGAGGGCTGGAGG - Intronic
1069692433 10:70362793-70362815 GGGGGTGGAGTGAGGGCAGGGGG + Intronic
1069719222 10:70539254-70539276 AGGGGTGCCTAGAGGGCAGGGGG - Intronic
1070240379 10:74674290-74674312 TGGTGTGGAGAGGGAGCAGGGGG - Intronic
1074766893 10:116706296-116706318 CGGTGTGAGGAGAGGCCAGGCGG - Intronic
1074851132 10:117440494-117440516 GGGTGTGGCTGGAGGGCTGGAGG + Intergenic
1075073272 10:119333279-119333301 TGGTGAGGATGGTGGGCAGGGGG - Intronic
1075800101 10:125148390-125148412 CGCTGTGGTTAGTGGGAAGGGGG - Intronic
1076568029 10:131412135-131412157 GGGGGTGGTTAGAGGGCTGGGGG + Intergenic
1076568053 10:131412209-131412231 GGGGGTGGTTAGAGGGCTGGGGG + Intergenic
1077867952 11:6238865-6238887 TGCTGTGGAAAGAGGGGAGGAGG + Intronic
1078000526 11:7491211-7491233 GGGTGAGGATAGAGGTGAGGGGG + Intronic
1080052437 11:27871020-27871042 TGGAGTGGTTAGAGGGCAGTAGG + Intergenic
1083285539 11:61656467-61656489 CGGGGTGGTGAGAGTGCAGGGGG + Intergenic
1083681343 11:64353239-64353261 AGGTGTGGCTGGAGGGCCGGTGG + Exonic
1085238611 11:75033741-75033763 CAGTGTGGGAAGAGGTCAGGAGG + Intergenic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085527941 11:77174923-77174945 CTGAGTGCACAGAGGGCAGGAGG + Intronic
1086374091 11:86183075-86183097 CGGTGTGGATAGAAGAGAAGAGG + Intergenic
1087188655 11:95230622-95230644 GGGCGTGGGTTGAGGGCAGGAGG - Intronic
1089736976 11:120556356-120556378 GGGAGTGGAGAGAGGACAGGTGG - Intronic
1090192038 11:124778512-124778534 CTGTAGGGATAGAGGTCAGGAGG + Intronic
1090740424 11:129654606-129654628 CAGTGTGGAGAGGGAGCAGGTGG - Intergenic
1091402836 12:191046-191068 GGGTGTGGCCAGAGGCCAGGCGG - Exonic
1091543121 12:1480736-1480758 GGGTGTGGGTAGTGGGCAGGGGG + Intronic
1091617367 12:2059599-2059621 CTGTGTGTATAGGGGGCAAGGGG + Intronic
1091893776 12:4083965-4083987 GGGAGTGGGTAGTGGGCAGGTGG - Intergenic
1091947598 12:4562254-4562276 CGGTGCGGATAGGCGGCGGGAGG - Intronic
1092015522 12:5155524-5155546 GGGTGTGGATAAAGGGGAGGTGG - Intergenic
1092045487 12:5429743-5429765 CTTTGTGGAGAGAGGGGAGGAGG - Intergenic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1094818444 12:34207709-34207731 AGGGATGGATAGAGGGAAGGAGG - Intergenic
1096567964 12:52496830-52496852 CAGTGTGGAGGGAGGACAGGAGG + Intergenic
1096651207 12:53062747-53062769 CATTGTGGATACAGGGCATGGGG + Intronic
1097011317 12:55955409-55955431 GGGAGTGGATAGAGGGCAGCTGG - Intronic
1097054264 12:56240466-56240488 CGGTGGGGAGAGGGGGGAGGGGG + Exonic
1101583544 12:106065426-106065448 AGGTGTTGAAAGAGTGCAGGGGG - Exonic
1102124518 12:110469171-110469193 TGTTGTGGACAGAGGGCAGAGGG + Intronic
1103004404 12:117409538-117409560 AGGGGTGGATAGAGGGTAGATGG + Intronic
1103075005 12:117974910-117974932 GGGTGCGGAGAGAGGGCAGCAGG - Intergenic
1103848956 12:123918613-123918635 AGATGTGGGCAGAGGGCAGGAGG - Intronic
1104400113 12:128468241-128468263 GGGTGTGCAGGGAGGGCAGGGGG + Intronic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1113531937 13:111033502-111033524 CAGTGTGTGTACAGGGCAGGGGG + Intergenic
1113787737 13:113011482-113011504 CGGTGTGGATGGTGGACAGGTGG + Intronic
1113787761 13:113011605-113011627 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787827 13:113011932-113011954 CGGTGTGGATGGTGGACAGGCGG + Intronic
1113787857 13:113012096-113012118 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787873 13:113012177-113012199 CAGTGTGGATGGTGGACAGGCGG + Intronic
1113787895 13:113012300-113012322 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787926 13:113012463-113012485 TGGTGTGGATGGTGGACAGGCGG + Intronic
1113787968 13:113012689-113012711 CAGTGTGGATGGTGGACAGGTGG + Intronic
1118796940 14:69152665-69152687 GGGTGGGGACAGAGGGCAGGAGG + Intronic
1121552595 14:94813660-94813682 CCTTGTGGGTAGAGGCCAGGGGG + Intergenic
1122406644 14:101504822-101504844 GGGTGTGGAGAGCTGGCAGGAGG + Intergenic
1122530136 14:102419488-102419510 TGGTGGGGACAGAGTGCAGGCGG + Intronic
1122696787 14:103558167-103558189 CGGTGGGGTCAGAGGGCAGTCGG - Intronic
1123039130 14:105483246-105483268 AGGTGTGGAAAGAGGGAAGAAGG - Intergenic
1123061574 14:105597030-105597052 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123061589 14:105597071-105597093 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123061603 14:105597112-105597134 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123085994 14:105717860-105717882 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086008 14:105717901-105717923 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086022 14:105717942-105717964 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086051 14:105718023-105718045 GGCTGTGGATAGATGGCAGGAGG + Intergenic
1123086065 14:105718064-105718086 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086079 14:105718105-105718127 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086093 14:105718146-105718168 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086138 14:105718268-105718290 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086153 14:105718309-105718331 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086167 14:105718350-105718372 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086182 14:105718391-105718413 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086196 14:105718432-105718454 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086211 14:105718473-105718495 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086225 14:105718514-105718536 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086240 14:105718555-105718577 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086254 14:105718596-105718618 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086269 14:105718637-105718659 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086283 14:105718678-105718700 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086298 14:105718719-105718741 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086312 14:105718760-105718782 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1123086327 14:105718801-105718823 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086341 14:105718842-105718864 GGCTGAGGATAGATGGCAGGAGG + Intergenic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1129255079 15:74329900-74329922 AGGTGTGGACACAGGGGAGGAGG - Intronic
1130128719 15:81117884-81117906 TGGTGTGGATAAAGAGGAGGAGG - Intronic
1130253418 15:82315011-82315033 AGGTGTGGAGAGAGGCTAGGAGG - Intergenic
1132514534 16:360044-360066 CGCTGGGGATAGTGGGCAGAAGG - Intergenic
1132936674 16:2484731-2484753 CGGTGGGGCTATATGGCAGGAGG + Intronic
1133266387 16:4586912-4586934 CCGTGTGGACAGCAGGCAGGTGG - Intronic
1134414295 16:14030326-14030348 CAGTGTGGTTAGAGGGCAGAGGG - Intergenic
1136155619 16:28380210-28380232 CGGGGTGGGAAGCGGGCAGGTGG - Intronic
1136155637 16:28380261-28380283 CGGGGTGGGAAGCGGGCAGGTGG - Intronic
1136207447 16:28735028-28735050 CGGGGTGGGAAGCGGGCAGGTGG + Intronic
1136207465 16:28735079-28735101 CGGGGTGGGAAGCGGGCAGGTGG + Intronic
1136220733 16:28826423-28826445 CTGTGTGCATAGAGGACAGAGGG + Intronic
1137075121 16:35952537-35952559 CGGTGTGGGGTGGGGGCAGGGGG - Intergenic
1142030869 16:87837892-87837914 TGGAGAGGATGGAGGGCAGGTGG + Exonic
1142559727 17:802889-802911 ATGGGTGGATGGAGGGCAGGGGG + Intronic
1143332878 17:6150344-6150366 GGGTGTGGAGAGAGGGAGGGAGG + Intergenic
1143370398 17:6435687-6435709 CGATGTGGAGAGAGGCCTGGAGG + Intergenic
1143405581 17:6675229-6675251 CCGTGTGGAGAAAGGGCAGTTGG - Intergenic
1144620714 17:16816765-16816787 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1144711314 17:17403462-17403484 AGGTCTGGACAGAGGGGAGGAGG + Intergenic
1144761711 17:17710936-17710958 GGGTGTTGATGGGGGGCAGGTGG + Intronic
1145147293 17:20492995-20493017 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1145787599 17:27604126-27604148 CGGGTTGGATAGAGGGCATTTGG + Intronic
1147317621 17:39628253-39628275 GGGGGGAGATAGAGGGCAGGGGG + Intronic
1147572104 17:41577663-41577685 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1147968508 17:44207076-44207098 CGGTGGGGGTAGGGGGCTGGAGG - Exonic
1151572223 17:74932562-74932584 AGGTGGGGCCAGAGGGCAGGGGG - Intronic
1152031567 17:77846435-77846457 CGGTGGGGAAAGGGGGCCGGAGG - Intergenic
1152060955 17:78074864-78074886 CGGAGAGGATAGAGGGCGGCAGG + Intronic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1154217101 18:12423352-12423374 CCCTGTGGAGAGAGGGCCGGGGG + Intronic
1154433176 18:14324008-14324030 GGGTGGGGTTAGAGGGAAGGGGG + Intergenic
1155949539 18:31895413-31895435 TGGTGGGGAGAGGGGGCAGGTGG - Intronic
1157095437 18:44681961-44681983 AGGTGTGGATAGTTGGCAGGAGG - Intronic
1157493560 18:48139773-48139795 GGGTGGGGAGAGAGGGCAAGGGG + Intronic
1157607931 18:48937884-48937906 CATTGTGGAGTGAGGGCAGGGGG - Intronic
1158492306 18:57921174-57921196 GGGAAAGGATAGAGGGCAGGAGG - Intergenic
1158796882 18:60856949-60856971 CGGTGGGGGGAGAGGGGAGGAGG - Intergenic
1159827104 18:73226977-73226999 CAGTGAGGAGGGAGGGCAGGGGG - Intronic
1160740878 19:685344-685366 CGGTGTGGTTAGGCGGCTGGAGG + Intergenic
1161053186 19:2176214-2176236 CTGTGTGGACCGAGGGCTGGGGG - Intronic
1161231336 19:3176531-3176553 CTGGGGGGACAGAGGGCAGGTGG + Intronic
1162588929 19:11578325-11578347 TGGGATGGAGAGAGGGCAGGGGG - Intronic
1162936279 19:13983269-13983291 CGCTGTGGAGACAAGGCAGGAGG + Exonic
1163021210 19:14481886-14481908 CTGTGGGGATAGATGGGAGGGGG - Intronic
1164561857 19:29297920-29297942 CGGTGTGGAAAGGGGGCAAGTGG - Intergenic
1166006327 19:39909857-39909879 GGGAGTGGACAGAGTGCAGGTGG - Intronic
1166151852 19:40880645-40880667 GGGGGTGGAGAGAGGTCAGGGGG + Intronic
1166178311 19:41090008-41090030 GGGGGTGGAGAGAGGTCAGGGGG - Intronic
1167101897 19:47408825-47408847 CTGGGTGGATGGTGGGCAGGTGG + Intronic
1167529172 19:50004281-50004303 CAGGGTGGGGAGAGGGCAGGAGG - Intronic
1167660145 19:50791627-50791649 CGGGGTGGAGAGAGGGCACGCGG - Intronic
1167788245 19:51653529-51653551 TGGGGAGGATAGAGGGCATGGGG + Intergenic
1167803970 19:51766342-51766364 GTCTGTGGATAGAGGCCAGGGGG + Intronic
925240884 2:2326198-2326220 CACTGTGGATAGTGGGCTGGTGG - Intronic
925533250 2:4887438-4887460 GGGTGTGGCTGGAGGGGAGGAGG + Intergenic
926446526 2:12949110-12949132 TAGTGTGGATAGAGGGCAAGCGG - Intergenic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
930766476 2:55090556-55090578 CCAGGTGGATAGAGGGGAGGTGG - Intronic
931248474 2:60510288-60510310 CAGAGTGGAAAGAGTGCAGGAGG - Intronic
932143086 2:69296824-69296846 TGGTGTGGAAAGAGGGTTGGGGG - Intergenic
932418691 2:71588721-71588743 CAGTTTGGGTAGTGGGCAGGAGG + Intronic
933943704 2:87266461-87266483 CTGTGTGGACAGTGGGCTGGAGG + Intergenic
935734614 2:106096914-106096936 TGGTGTGAATAGGGTGCAGGCGG + Intronic
936336516 2:111595118-111595140 CTGTGTGGACAGTGGGCTGGAGG - Intergenic
937760170 2:125591176-125591198 CGGGGTGGGTAGGGGGCAAGAGG + Intergenic
939195948 2:138972394-138972416 CAGGGTGGAGAGAAGGCAGGAGG + Intergenic
942919338 2:181352327-181352349 CGGGGAGGAAAGAGGGTAGGAGG - Intergenic
946183065 2:217960469-217960491 AGGGGTGGATGCAGGGCAGGGGG + Intronic
946326183 2:218985671-218985693 GGGTGGGGATAGAGGGAGGGAGG - Intergenic
947463585 2:230323170-230323192 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
947472421 2:230411733-230411755 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
947753209 2:232543463-232543485 GGGGGTGGATGGAGGGCAAGAGG - Intronic
948048120 2:234958888-234958910 TGGTGTGGAGACAGGGCAGGAGG + Intronic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948382392 2:237559812-237559834 GGGTGTGGACAGAGGACAGGTGG - Intergenic
948566004 2:238886667-238886689 GGGTGGAGACAGAGGGCAGGTGG + Intronic
948591039 2:239050342-239050364 CGGCGGGGTAAGAGGGCAGGTGG + Exonic
948917011 2:241039528-241039550 CGGTGAGGAGGGAGGGCAGAGGG + Intronic
948951560 2:241255617-241255639 AGGTGTGGGAAGCGGGCAGGTGG + Intronic
1168737101 20:149875-149897 CAGTGAGGATAGAGGATAGGAGG + Intergenic
1168975589 20:1963144-1963166 AGGGGTGGATAGAGGGAAGAAGG + Intergenic
1169141664 20:3230291-3230313 GGGTGTGGTCAGGGGGCAGGTGG + Intronic
1169516861 20:6326219-6326241 GGGTGTGGAGGGAGGGAAGGTGG + Intergenic
1170588533 20:17753641-17753663 AGGTGTGGAAACAGGGCTGGTGG - Intergenic
1172284271 20:33730245-33730267 GGGAGTGCATAGAGGGGAGGGGG - Intergenic
1172514956 20:35527027-35527049 CTGGGTGGGTAAAGGGCAGGAGG - Exonic
1173664982 20:44757036-44757058 CGCTGGGGATAGAGGCCAGCAGG + Exonic
1173741496 20:45405722-45405744 GGGGGTGGATGGAAGGCAGGAGG + Intronic
1176195447 20:63834764-63834786 CAGTGAGGGTGGAGGGCAGGTGG - Intergenic
1179170704 21:38970733-38970755 CCGTGGGAAGAGAGGGCAGGTGG - Intergenic
1179555285 21:42171343-42171365 AGGTGAGGACAGAGGGGAGGAGG - Intergenic
1181388817 22:22564388-22564410 CTGGGTGTACAGAGGGCAGGAGG + Exonic
1181434238 22:22900950-22900972 CGGGGTGGATGAGGGGCAGGGGG - Intergenic
1181435174 22:22906316-22906338 CGGGGTGGATGAGGGGCAGGGGG - Intergenic
1181437580 22:22919509-22919531 CGGGGTGGATGAGGGGCAGGGGG - Intergenic
1181438224 22:22922568-22922590 CGGGGTGGATGAGGGGCAGGGGG - Intergenic
1182364174 22:29766808-29766830 GGGTGTGGATAGAGGGGCGAGGG - Intronic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183553445 22:38506804-38506826 CGGTGGGGCGAGAGGGCTGGCGG - Intronic
1185215986 22:49600241-49600263 CGTGGTGGAGGGAGGGCAGGTGG - Intronic
1185272885 22:49936764-49936786 GGGTGTGGATGGAGGGCTGTGGG - Intergenic
950809181 3:15635014-15635036 TAGTATGGATAGAGGGCAGAGGG + Intronic
952702468 3:36341478-36341500 CAGTGTGGGTAGGGGCCAGGTGG + Intergenic
952882194 3:37991810-37991832 CCCTGAGGAAAGAGGGCAGGAGG + Intronic
953786782 3:45917060-45917082 CGGTGGGGAGAGAAGGGAGGAGG + Intergenic
955281178 3:57596684-57596706 GGGTGTGGACAGCGGTCAGGAGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
961657977 3:128453732-128453754 CAGTGTGGTTGGCGGGCAGGTGG + Intergenic
961659195 3:128459404-128459426 CGGCGGGGACAGAGGTCAGGTGG + Intergenic
962203062 3:133415802-133415824 AGGGGTGAATAGAGGGGAGGTGG - Intronic
964982540 3:162703290-162703312 AGGTGTGGAAAGAGAGCGGGCGG - Intergenic
966868509 3:184275894-184275916 CGGTGTTGCTGGAGGGCAGCTGG + Intronic
968917502 4:3503003-3503025 TGGTGTGGCTCGAGGGCAGTGGG - Intergenic
969213003 4:5702009-5702031 GGGTGAGAATAGATGGCAGGCGG - Intronic
969608307 4:8213097-8213119 CCTTGTGGGTGGAGGGCAGGTGG - Intronic
970141644 4:12989332-12989354 CGGCGGGGATGGGGGGCAGGGGG + Intergenic
970538585 4:17055211-17055233 CAGTGTTGAGAGAGGGCTGGGGG - Intergenic
973733478 4:53846157-53846179 CGGTCTAGATAGAGGGTAGAAGG + Intronic
974409240 4:61517529-61517551 CGGTGGGGAGAGAGGGCTGGGGG + Intronic
974761773 4:66285545-66285567 CAGTGCTGATGGAGGGCAGGAGG + Intergenic
975361615 4:73477304-73477326 CAGTGTGGAGAGGGAGCAGGTGG + Intergenic
976569924 4:86595371-86595393 CGGTGGGGCTAGGGGGCCGGAGG - Intronic
976591223 4:86851483-86851505 CAGTGCTGATAGAGGGGAGGGGG + Intergenic
976600938 4:86936467-86936489 CGGTGTGTGTAGAAGGTAGGTGG + Intronic
977826926 4:101543576-101543598 GGGTGTGTGTTGAGGGCAGGGGG + Intronic
984821939 4:183889753-183889775 AGGTGTAGAAAGAGGGGAGGTGG - Intronic
985477728 5:89216-89238 GTGTGTGGACAGAGGGGAGGAGG - Intergenic
986154074 5:5156116-5156138 GGATGTGAATAGAGAGCAGGTGG + Intronic
986317680 5:6601514-6601536 CCATGTGGAGAGAGGACAGGTGG - Intronic
986456760 5:7927633-7927655 AGGTGTGCACAGAAGGCAGGTGG + Intergenic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
992071585 5:73153946-73153968 TGGTGTAGAAAGAGGGCAAGGGG - Intergenic
994611065 5:102040347-102040369 TTGTGTGTATAGAGGGGAGGGGG - Intergenic
995126935 5:108586885-108586907 GGGTGGGGAGAGAGGGAAGGGGG + Intergenic
996423264 5:123285654-123285676 AGGGGTGGGTGGAGGGCAGGAGG - Intergenic
996862560 5:128083325-128083347 CTGGGTGGAGAGAGGGGAGGTGG + Intergenic
998132501 5:139658523-139658545 CGGTGTGGAGAGTGGGCTGTGGG + Intronic
998485391 5:142497742-142497764 CGCTGTCGAAAGAGGGGAGGGGG - Intergenic
999925024 5:156366178-156366200 CTGTGTGAAGAGAGGGCATGTGG + Intronic
1001806504 5:174591313-174591335 CGGAGAGGAGAGAAGGCAGGTGG - Intergenic
1002447173 5:179296655-179296677 CGGCCTGGGCAGAGGGCAGGAGG + Intronic
1005500068 6:26421775-26421797 CGGCGTGGATCGCGGGGAGGAGG + Intergenic
1007337377 6:41163247-41163269 GGGTGGGGACAGAGGGGAGGAGG + Intergenic
1007482373 6:42158504-42158526 AGGTGTGGACCCAGGGCAGGTGG + Intronic
1009828058 6:68892945-68892967 TGGTGTAGATAGAAGTCAGGTGG - Intronic
1012882515 6:104807682-104807704 AGGTGTGTAAAGATGGCAGGGGG + Intronic
1012930507 6:105311330-105311352 GGGAGTGGATGAAGGGCAGGGGG - Intronic
1014474937 6:121860408-121860430 AGGTGTGGATAAAGGGTAGCAGG + Intergenic
1018186533 6:161269817-161269839 GGGGGTGGATAGAGGACAGATGG + Intronic
1018970682 6:168526512-168526534 GGGTGTGGGGAGAAGGCAGGTGG + Intronic
1019101600 6:169635223-169635245 AGGTGTGGTTGGGGGGCAGGTGG + Intronic
1019762032 7:2820188-2820210 CGGTGTCGAAAGTGGGCTGGTGG + Intronic
1019827920 7:3299961-3299983 TGGTGTGGAAAGGGGGCAGATGG + Intergenic
1019892027 7:3954570-3954592 CGGAGAGTATAGAGGGGAGGCGG - Intronic
1021745390 7:23735639-23735661 CAGTGTGGATATAGGGGAAGAGG + Exonic
1022487906 7:30794505-30794527 AGGTGGGGTTAGGGGGCAGGTGG + Intronic
1022498584 7:30868517-30868539 ATGTATGGACAGAGGGCAGGTGG + Intronic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1024814076 7:53247434-53247456 CGATGTGGAAAGAAGGCTGGAGG - Intergenic
1026023739 7:66729471-66729493 AGGTGAGGATGGAGAGCAGGAGG - Intronic
1026875779 7:73878369-73878391 AGGGGTGGACACAGGGCAGGTGG - Intergenic
1029606268 7:101601221-101601243 CAGTGTGGAAAAGGGGCAGGTGG + Intergenic
1029688508 7:102165140-102165162 AGGTGTGGGGAGAGGGCTGGGGG - Intronic
1032706405 7:134424035-134424057 CTGTGAGGGAAGAGGGCAGGTGG + Intergenic
1033242245 7:139689990-139690012 CGGTGTGCACAGGGGGCTGGGGG + Intronic
1033446718 7:141429531-141429553 TGGTGTGGTTAGAGGTTAGGAGG + Intronic
1035359455 7:158300771-158300793 CCGTGTGGAGGGAGGGGAGGTGG + Intronic
1035640926 8:1184683-1184705 GGGTGTGGTTAGGGAGCAGGAGG + Intergenic
1037818757 8:22125501-22125523 CGATCTGGAGAGAGGGCAGGGGG + Exonic
1041421089 8:57667546-57667568 GGGTGTGGAGAGCAGGCAGGAGG + Intergenic
1043171499 8:76972344-76972366 CGGTGTGGGTGGGGGGCAGCAGG + Intergenic
1043212475 8:77540358-77540380 CGGTGTGGCAGGAGGGCTGGAGG + Intergenic
1044619638 8:94176255-94176277 CATAGTGGATAGAGGTCAGGGGG + Intronic
1048171622 8:132112166-132112188 TGGTGTGGGTAGAGGGAATGGGG - Intergenic
1048193123 8:132308369-132308391 AGGGATGGATGGAGGGCAGGGGG + Intronic
1049150989 8:141035446-141035468 CAGTGGGGAGCGAGGGCAGGAGG - Intergenic
1049403374 8:142440807-142440829 CTGGGTAGACAGAGGGCAGGAGG - Intergenic
1051342179 9:16121523-16121545 CGGTGTGCAGAGAGGGTGGGGGG + Intergenic
1051502436 9:17792627-17792649 AGGTTTGGACAGAGGGAAGGAGG - Intronic
1052993888 9:34539359-34539381 CGCTGTGGCTACAGGGGAGGTGG - Intergenic
1055742086 9:79401255-79401277 AGGAGTGGATAGAAGGAAGGAGG - Intergenic
1056328437 9:85501681-85501703 AGGTGTGGATGAAGTGCAGGTGG - Intergenic
1056765411 9:89441869-89441891 CCGTGTGGACAGAGGGCTAGAGG + Intronic
1057314319 9:93958889-93958911 GGGTGTGGGTGGAGGGGAGGTGG - Intergenic
1057873744 9:98737116-98737138 ATGTGTGTATAGGGGGCAGGGGG - Intronic
1058189704 9:101898335-101898357 GTGTGTGGCAAGAGGGCAGGGGG + Intergenic
1060299705 9:122368101-122368123 TGGTGTGGATAATGGGGAGGGGG + Intergenic
1060319891 9:122548739-122548761 GGGTGGGGGTAGAGGGGAGGGGG - Intergenic
1060398819 9:123335500-123335522 CTGTGAGGGCAGAGGGCAGGTGG - Intergenic
1060954565 9:127629375-127629397 CTGTGTGGAGAGTGGGCGGGAGG + Intronic
1062016938 9:134295780-134295802 CGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062016946 9:134295807-134295829 CGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062016954 9:134295834-134295856 CGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062480668 9:136749421-136749443 CTGCGTGGGTACAGGGCAGGTGG - Intergenic
1062534919 9:137017175-137017197 CGGTGAGGGTCGCGGGCAGGCGG - Exonic
1185566595 X:1099686-1099708 GGGTGTGGGCAGAGGGCAGGAGG + Intergenic
1185979807 X:4765383-4765405 CAGTGTGGTTCGAGGGGAGGAGG + Intergenic
1187077196 X:15947035-15947057 CGGTGGGGGTAGGGGGGAGGCGG + Intergenic
1188656144 X:32698017-32698039 GGGAGTGGATAGAGAGGAGGGGG + Intronic
1190005709 X:46735892-46735914 GGGTGCGGGGAGAGGGCAGGGGG - Intronic
1190396299 X:49988525-49988547 GGGTGTGTATAGAGAGCCGGGGG - Intronic
1193521478 X:82535132-82535154 CGGTGAGGATATAAGGCAGGCGG + Intergenic
1196997914 X:121404264-121404286 CAGTGGGGATAGAGGGGATGGGG - Intergenic
1197324335 X:125073685-125073707 CAGTATGGATAGTGTGCAGGAGG + Intergenic
1200684458 Y:6246418-6246440 CGGGGTGGAGAGTGAGCAGGCGG + Exonic
1200687100 Y:6266742-6266764 CGGGGTGGAGAGTGAGCAGGCGG + Intergenic
1200989981 Y:9337659-9337681 CGGGGTGGAGAGTGAGCAGGCGG + Exonic
1200992649 Y:9357992-9358014 CGGGGTGGAGAGTGAGCAGGCGG + Exonic
1200995303 Y:9378271-9378293 CGGGGTGGAGAGTGAGCAGGCGG + Intronic
1200997967 Y:9398616-9398638 CGGGGTGGAGAGTGAGCAGGCGG + Exonic
1201000476 Y:9467150-9467172 CGGGGTGGAGAGTGAGCAGGCGG + Exonic
1201003138 Y:9487462-9487484 CGGGGTGGAGAGTGAGCAGGCGG + Exonic
1201005797 Y:9507745-9507767 CGGGGTGGAGAGTGAGCAGGCGG + Intergenic
1201008457 Y:9528075-9528097 CGGGGTGGAGAGTGAGCAGGCGG + Exonic
1201011042 Y:9548252-9548274 CGGGGTGGAGAGTGAGCAGGCGG + Intergenic
1201048174 Y:9907968-9907990 CGGGGTGGAGAGTGAGCAGGCGG - Intergenic
1201383535 Y:13413330-13413352 CGGTGTGGATAGAGGGCAGGAGG - Intronic