ID: 1201383543

View in Genome Browser
Species Human (GRCh38)
Location Y:13413350-13413372
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 2, 1: 1, 2: 5, 3: 26, 4: 214}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201383543_1201383550 -3 Left 1201383543 Y:13413350-13413372 CCGGGTGGCTGCCCCATGTGACA 0: 2
1: 1
2: 5
3: 26
4: 214
Right 1201383550 Y:13413370-13413392 ACAGGAAGCAGCAGGGTGCCAGG 0: 1
1: 0
2: 4
3: 101
4: 534
1201383543_1201383549 -10 Left 1201383543 Y:13413350-13413372 CCGGGTGGCTGCCCCATGTGACA 0: 2
1: 1
2: 5
3: 26
4: 214
Right 1201383549 Y:13413363-13413385 CCATGTGACAGGAAGCAGCAGGG 0: 1
1: 0
2: 3
3: 33
4: 339
1201383543_1201383553 16 Left 1201383543 Y:13413350-13413372 CCGGGTGGCTGCCCCATGTGACA 0: 2
1: 1
2: 5
3: 26
4: 214
Right 1201383553 Y:13413389-13413411 CAGGCCAGCCCAGGAGCCGTCGG 0: 4
1: 7
2: 18
3: 60
4: 332
1201383543_1201383557 27 Left 1201383543 Y:13413350-13413372 CCGGGTGGCTGCCCCATGTGACA 0: 2
1: 1
2: 5
3: 26
4: 214
Right 1201383557 Y:13413400-13413422 AGGAGCCGTCGGCTTAAGCCAGG 0: 1
1: 0
2: 1
3: 2
4: 36
1201383543_1201383551 7 Left 1201383543 Y:13413350-13413372 CCGGGTGGCTGCCCCATGTGACA 0: 2
1: 1
2: 5
3: 26
4: 214
Right 1201383551 Y:13413380-13413402 GCAGGGTGCCAGGCCAGCCCAGG 0: 1
1: 1
2: 2
3: 78
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201383543 Original CRISPR TGTCACATGGGGCAGCCACC CGG (reversed) Intronic
900562049 1:3312074-3312096 TGTCGCATGGGGGAGCAGCCGGG - Intronic
901682627 1:10922904-10922926 TGCCAAATGGTGCAGCCACTTGG + Intergenic
902032258 1:13431373-13431395 TGACACAGGGAGCAGACACCAGG + Intergenic
902449283 1:16486396-16486418 TGCCCCATGTGGCACCCACCAGG + Intergenic
902615915 1:17623451-17623473 AGTCACTGTGGGCAGCCACCTGG + Intronic
902618324 1:17635909-17635931 TGGCCCATGAGGCAGCCTCCTGG - Intronic
902821627 1:18946987-18947009 TGTCACATGATGCTGCCACATGG + Intronic
902830683 1:19010415-19010437 TGTCTGATGGGTCAGCCAGCGGG + Intergenic
904065203 1:27744505-27744527 TGTCACAGGGGGCTGCTACAAGG - Intronic
904323258 1:29710327-29710349 TGTAGAATGGGGCAGCCCCCAGG - Intergenic
904784134 1:32973031-32973053 GGTCACATGGCACCGCCACCGGG - Intergenic
907110184 1:51920031-51920053 TGTCACAAATGGCATCCACCAGG + Exonic
907398633 1:54210260-54210282 TGTCTCATGGGGCTGCCACATGG - Intronic
907453799 1:54562603-54562625 TCTCAGATGGGGCAGCTGCCGGG + Intronic
907783710 1:57591337-57591359 TTTCACATGGGCCAGTCACCAGG - Intronic
914965810 1:152256359-152256381 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
916146804 1:161747121-161747143 TGTAAAATGGTGCACCCACCAGG - Intergenic
916355373 1:163900034-163900056 TGGCTCATGGGCCAGCCAGCAGG + Intergenic
917456769 1:175192682-175192704 TGTCAGACGGGGCAGCAACCAGG - Exonic
917721473 1:177790515-177790537 TGTGATATTGGGCAGCCACTTGG - Intergenic
919423883 1:197405796-197405818 TCTCAGACGGGGCAGCTACCGGG - Intronic
921050603 1:211508742-211508764 TGGCAGATGGGGCAGGCTCCTGG - Intergenic
923456459 1:234169477-234169499 TGTCACAACGGGCAGCCAGAGGG + Intronic
1062876787 10:949085-949107 TGTAAGATGGTACAGCCACCTGG - Intergenic
1062876849 10:949410-949432 TGTAAGATGGTACAGCCACCTGG - Intergenic
1063447309 10:6127531-6127553 GGTCACAAGGGCCAGCCTCCAGG + Intergenic
1066421374 10:35267636-35267658 TGTCACAAGAGGGAGCAACCAGG - Intronic
1067034162 10:42900536-42900558 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1067077557 10:43196863-43196885 TGTGGCATGGAGCAGCCAGCAGG + Intronic
1067120076 10:43465424-43465446 TCTCAGATGGGGCAGCTGCCGGG + Intronic
1067258625 10:44666737-44666759 TGTCACATGGGGTGGCTGCCTGG + Intergenic
1067512151 10:46905020-46905042 GGCCACATGGGGAAGACACCAGG - Intergenic
1068645203 10:59458333-59458355 TCTCATATGTGGAAGCCACCTGG - Intergenic
1069748872 10:70733136-70733158 TGCAACATGGGGCTGACACCAGG + Intronic
1070757973 10:79005293-79005315 GGTCACAGGGTGCAGCCAGCAGG + Intergenic
1072154965 10:92715771-92715793 TGCGACATGGTACAGCCACCAGG - Intergenic
1072816432 10:98513811-98513833 TGTCAAATGGTACAGCCACTAGG + Intronic
1073977164 10:109115152-109115174 TCTCACATGTGGCAGCTCCCAGG + Intergenic
1074079541 10:110156811-110156833 AGTCCCCTGGGGCAGCCACTGGG + Intergenic
1075353738 10:121751399-121751421 TGTCAAATGAGGCGGCCACTTGG - Intronic
1076471719 10:130723810-130723832 TTGCACATGGAGCAGCCCCCAGG + Intergenic
1076979804 11:198359-198381 TGTGACATGGGGCAGCCCGACGG + Intronic
1077317120 11:1924594-1924616 TTTCTCTTGGGGCAGCCACGTGG + Intronic
1078237940 11:9503441-9503463 TGTAAAATGGTGCAGCCACTTGG - Intronic
1078667525 11:13339053-13339075 TGTCACATGGGGCATGTACCTGG + Intronic
1081857091 11:46310815-46310837 TGTCAGATGAGGCAGCACCCAGG + Intronic
1082166431 11:48955683-48955705 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1083279985 11:61620920-61620942 GGTCACCTGAGGCAGCCACTCGG + Intergenic
1083477173 11:62922065-62922087 CCGCACATGGGGCAGGCACCTGG - Intergenic
1084924812 11:72502738-72502760 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1085480866 11:76821569-76821591 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1085508824 11:77075025-77075047 TTTCCCATGTGGCAGCCACATGG + Intronic
1086818683 11:91406579-91406601 TGTCCCATGGGGCAGCTGCCTGG + Intergenic
1089500277 11:118928030-118928052 TGTCCTATGGAGCAGCCACGCGG + Intronic
1092185518 12:6475730-6475752 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1092538935 12:9407647-9407669 TGTCACATCGGGTAGCCCCAGGG - Intergenic
1092651370 12:10638956-10638978 TGATCCATGTGGCAGCCACCTGG - Intronic
1094319853 12:29172234-29172256 TCCCAGATGGGGCAGCGACCAGG - Intronic
1095068828 12:37815115-37815137 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1096478253 12:51921673-51921695 TGTCACATGGAGCAAACATCCGG - Intronic
1097908965 12:64948908-64948930 TGTCACATTGGGCAGGCAGTGGG + Intergenic
1101452055 12:104788914-104788936 GGTCACATGGGGAAGCCACATGG + Intergenic
1102017520 12:109657491-109657513 TGGTAAAGGGGGCAGCCACCAGG + Intergenic
1102512191 12:113423007-113423029 TGTCCCGTATGGCAGCCACCAGG - Intronic
1103478971 12:121238744-121238766 TGCCCCCTGGGCCAGCCACCAGG + Exonic
1104419173 12:128621112-128621134 GTTCACATGGGCCAGCCCCCAGG - Intronic
1104591446 12:130087374-130087396 TGCCACATTGAGCAGCCAGCTGG - Intergenic
1104824365 12:131698207-131698229 TGTAACATGTAGCAGCCACCTGG + Intergenic
1105005704 12:132719317-132719339 TGTCACCTGGGCCTGTCACCAGG + Intronic
1105439409 13:20402899-20402921 GGGCACATGGGGCAGGCAGCTGG + Intergenic
1106394063 13:29363190-29363212 TGTTTCATGGGAGAGCCACCAGG - Intronic
1110730721 13:78876385-78876407 TGTCACATGGGGCAGCCACCTGG + Intergenic
1111091577 13:83453461-83453483 TGTTGCATGGGGTGGCCACCTGG - Intergenic
1112394755 13:99019488-99019510 TGTCATAAGAGGGAGCCACCTGG - Intronic
1114643092 14:24237703-24237725 TATCATCTGGGGCAGCCAGCAGG + Intronic
1120760889 14:88284261-88284283 TGTCACATTGAGCATGCACCTGG + Intronic
1122151720 14:99729427-99729449 TGCTGCATGGGGAAGCCACCTGG + Intergenic
1122392313 14:101398284-101398306 TGGCACTTTGCGCAGCCACCGGG + Intergenic
1123971644 15:25513418-25513440 GGTCACATGGGGAGGCCACATGG - Intergenic
1124267296 15:28248183-28248205 TGTCACATGGGGGAGCCAGCTGG - Intronic
1126624862 15:50676909-50676931 GTACACATGGGGCAGCCTCCAGG + Intronic
1130340836 15:82998367-82998389 TCTCAGATGGGGCAGCTGCCGGG + Intronic
1131129925 15:89891787-89891809 TGTAAAATGGTGCAGCCACTTGG + Intronic
1131696506 15:94882574-94882596 TGTCACGTGGGGCAGCTGCTTGG + Intergenic
1132360379 15:101207963-101207985 AGTCACATAGGGAAGGCACCGGG + Intronic
1134242650 16:12517351-12517373 TGTCACATGGGGCTCCCAGGAGG - Intronic
1134437633 16:14276173-14276195 TGTAAAATGGTGCAGCCACTTGG + Intergenic
1135619545 16:23943898-23943920 GATCACATGGGGAAGGCACCAGG + Intronic
1136605323 16:31329869-31329891 TGTCATATGGGACCGCCCCCAGG + Exonic
1139394739 16:66631017-66631039 TCTCAGATGGGGCGGCCGCCGGG - Intronic
1141394737 16:83694645-83694667 GGTGACATGGGCCAGCAACCAGG + Intronic
1143335816 17:6170806-6170828 CATCACATGGGGCAGCCGGCTGG - Intergenic
1144762534 17:17715483-17715505 CCTCCCATGGTGCAGCCACCTGG + Intronic
1144876092 17:18398192-18398214 TGTCACCTGGGCCTGTCACCTGG + Intergenic
1145156136 17:20546228-20546250 TGTCACCTGGGCCTGTCACCTGG - Intergenic
1148064246 17:44857139-44857161 TGACAACTGGGTCAGCCACCTGG + Exonic
1148775196 17:50091321-50091343 TGTCACAAGGTCCAGCCTCCAGG + Intergenic
1152181627 17:78825743-78825765 GGGCACAGGGTGCAGCCACCTGG - Intronic
1152359482 17:79824719-79824741 TGCCACATGGATCAACCACCAGG + Intergenic
1152748840 17:82053250-82053272 TGCAACATGGGCCAGGCACCTGG - Intronic
1155073102 18:22333270-22333292 AGTGTCTTGGGGCAGCCACCTGG - Intergenic
1156408808 18:36808170-36808192 TGCCTCAATGGGCAGCCACCTGG + Intronic
1156864307 18:41871993-41872015 TGTGATATGGGGCTGGCACCAGG - Intergenic
1161499358 19:4605023-4605045 TGTGACAGGGGGCAGCACCCAGG + Intergenic
1162069967 19:8147583-8147605 TGCCAAATGGGGCAGCCCCGGGG + Intronic
1162747613 19:12807442-12807464 TGTCACATGATACAGCCACTGGG + Exonic
1163268330 19:16234471-16234493 TGTCCCCTGGTGCTGCCACCAGG - Exonic
1164106106 19:22107920-22107942 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1164386357 19:27773852-27773874 AGTGACAAGGGACAGCCACCTGG - Intergenic
1165547851 19:36556678-36556700 TGGCAGATGGGGCAGCAGCCAGG - Intronic
1166127987 19:40727619-40727641 TCTCAGATGGGGCTGCCACGTGG + Intronic
1166649915 19:44565029-44565051 TGTAAAATGGTGCAGCCACTTGG + Intergenic
1167432537 19:49462689-49462711 GGTCACATGCGGCAGCCCCCCGG - Exonic
1168563509 19:57403615-57403637 TGTCACATGGGGTGGCTGCCTGG - Intronic
925403035 2:3589286-3589308 TGTGAAATGGTGCAGCCAGCTGG - Intergenic
927314602 2:21667305-21667327 TGACACATGGGGAGGCCACTTGG + Intergenic
927869793 2:26616227-26616249 GGCCACATGGGGCAGCCAGCTGG + Intronic
932439705 2:71726116-71726138 TCTCCCATGTGGCAGCCACATGG - Intergenic
933420939 2:82044026-82044048 TGTTGCATGGGACAGCCACCTGG - Intergenic
933870101 2:86557715-86557737 TGTCACAAGTGGCATTCACCAGG - Intronic
934677518 2:96260155-96260177 TGTTACATGGGGCAGGCCCCTGG - Intronic
935645356 2:105329730-105329752 CGTCACGTGGGGCGGCCGCCAGG + Exonic
937275350 2:120680442-120680464 TGTGACATTGGGGCGCCACCTGG + Intergenic
937286971 2:120760043-120760065 TCTCACAAGGGGCAGCCCCAGGG - Intronic
938340243 2:130531360-130531382 GGCCACATGGGGCAGCCCCAGGG + Intergenic
938349593 2:130589388-130589410 GGCCACATGGGGCAGCCCCAGGG - Intergenic
940303340 2:152198886-152198908 AGCCACATGGGGAAGCCACCAGG - Intergenic
940352062 2:152701889-152701911 TCTCACATGCTGCAGCAACCAGG + Intronic
940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG + Intergenic
941666104 2:168246225-168246247 TGTCACTTAGGGAAGCCTCCAGG - Intronic
942645669 2:178108248-178108270 AGTCACCTGGAACAGCCACCTGG + Intronic
943297188 2:186154207-186154229 TCTCACACGGGGCAGCTGCCAGG + Intergenic
946572788 2:221042872-221042894 TTTCACAAGGGGAATCCACCAGG + Intergenic
947810872 2:233003247-233003269 CCCCACCTGGGGCAGCCACCAGG - Intronic
948808655 2:240463705-240463727 TGTGACTTGGGGCAGCTGCCAGG + Intronic
948814101 2:240500901-240500923 AGTGACATGAGGCAGACACCGGG + Intronic
1171145055 20:22774370-22774392 TGACACAAGAGGCAGCCCCCAGG - Intergenic
1171848494 20:30291888-30291910 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1172686008 20:36755038-36755060 GGTTACATGGGTCAGCCTCCTGG - Intronic
1173125295 20:40331230-40331252 TGTCCAATATGGCAGCCACCAGG - Intergenic
1173866846 20:46317783-46317805 GGGCACATGGGGCTGCCATCCGG + Intergenic
1175226715 20:57448860-57448882 TTTCACCTGGCTCAGCCACCAGG + Intergenic
1175234094 20:57497049-57497071 TGTTAAATGGTGCAGCCACTGGG - Intronic
1176104806 20:63380918-63380940 TGCCACAGGGGGCAGCACCCAGG - Intergenic
1178391053 21:32198658-32198680 TGCCACTTGGGGCAGCAGCCAGG - Intergenic
1179623201 21:42632391-42632413 TGAGACATGGGGCAGCCACCGGG - Intergenic
1179794409 21:43774540-43774562 TATCTCAGGGGGCAGCCACAGGG + Intronic
1179995512 21:44972255-44972277 GTTCACATGGGACAGCGACCTGG - Intronic
1180190083 21:46158782-46158804 TGTCTCCTGGGGCAGCACCCGGG - Intergenic
1180882422 22:19215433-19215455 TTCCGCATGGGCCAGCCACCTGG - Intronic
1181860638 22:25815354-25815376 TGTCACATGGGGCACCTGCAGGG - Intronic
1182399806 22:30066778-30066800 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1184030408 22:41891066-41891088 TTTCTCCTGGAGCAGCCACCAGG + Intronic
1184281946 22:43442411-43442433 AGTCAGAAGGGGCAGCCACGGGG - Intronic
1185324947 22:50220975-50220997 TGTCAGATGTGGCTCCCACCAGG - Exonic
1185358919 22:50393440-50393462 TGACACATGGGAGAGACACCTGG + Intronic
953354915 3:42247809-42247831 TGGCACACTAGGCAGCCACCTGG + Intergenic
954997417 3:54894359-54894381 TGGCACCTAGGGCAGCCAGCAGG - Intronic
958932634 3:100224377-100224399 TGTAAAATGGTGCAGCCACTAGG + Intergenic
960862007 3:122164491-122164513 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
960990407 3:123306647-123306669 TGTAAAATGGGGCAGCCACTGGG + Intronic
961455239 3:127020702-127020724 GGGCCCAAGGGGCAGCCACCGGG - Intronic
961821283 3:129576983-129577005 TGTCACATCTGCCAGCCACAGGG - Intronic
965650076 3:170923796-170923818 TGTCAGATGGGGCGGCTGCCAGG - Intergenic
966255704 3:177914469-177914491 TGCCAGATGGGGCAGCAGCCAGG + Intergenic
967277934 3:187794994-187795016 TGTGACAAGGGTCAGACACCAGG + Intergenic
968925347 4:3544251-3544273 GGTCTGCTGGGGCAGCCACCTGG + Intergenic
969475655 4:7421198-7421220 AGTCAGAGGGGGCACCCACCTGG + Intronic
969575168 4:8032491-8032513 TGTGACATGGGGCACCCTCCTGG - Intronic
971376346 4:26058726-26058748 TGTCGAATGGGGAAACCACCTGG - Intergenic
971859377 4:32085473-32085495 TGTCATGTGGGGCAGCCAACTGG + Intergenic
973785059 4:54325718-54325740 TCTCAGATGGGGCAGCTACTGGG + Intergenic
976236058 4:82898781-82898803 TGTAAAATGGTGCAGCCACTAGG + Intronic
976729175 4:88245008-88245030 TGTCACATGGGACAGCTGCCTGG - Intergenic
982068655 4:151675836-151675858 TGACACATGGGGCAGAGACTCGG + Intronic
984082832 4:175270316-175270338 TGTCATATGGGGCATCTATCTGG - Intergenic
984943349 4:184952799-184952821 TGTCTCCTGGAGGAGCCACCAGG + Intergenic
985916301 5:2921406-2921428 TGTCGTGTGGGGCAGCCACCCGG - Intergenic
987858757 5:23456364-23456386 GGAAACATGGGGCAGCCACTGGG + Intergenic
988760671 5:34306906-34306928 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
995969943 5:117956123-117956145 AGGCACATGGAGCAGCCACATGG - Intergenic
997477069 5:134149450-134149472 TTTCACATGGGACAGCCACTGGG + Exonic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
999286113 5:150395242-150395264 TGTGACATGGAGTATCCACCTGG + Intronic
1002339831 5:178508545-178508567 TGTCACGTGGGGTGGACACCAGG + Intronic
1003164312 6:3663097-3663119 TGTCATCTGGGGGAGCCATCTGG + Intergenic
1003456972 6:6292319-6292341 AGTCACATAAGCCAGCCACCTGG + Intronic
1006451435 6:34107881-34107903 TGTCACAAGGAGGAGACACCTGG - Intronic
1009306924 6:62102659-62102681 TGTCACATGGGGTGGCTGCCAGG + Intronic
1010583251 6:77625865-77625887 TGTCATCTAGGGCAGCCAGCTGG - Intergenic
1012316857 6:97791440-97791462 TGTCATGTGGGACAGCCACCCGG + Intergenic
1012519676 6:100106149-100106171 GGCCACATGGGGAAGCAACCAGG + Intergenic
1014505268 6:122247521-122247543 TGTCATAGGATGCAGCCACCTGG + Intergenic
1014817665 6:125953234-125953256 TGTTGCATGGGGTGGCCACCTGG - Intergenic
1017722779 6:157255570-157255592 TTTCATGTGGGGCAGCCACGGGG - Intergenic
1017800723 6:157893462-157893484 CGACACATGGGGCAGACAGCTGG - Intronic
1019225263 6:170503237-170503259 GGTCACATCTGGCAGCCATCTGG + Intergenic
1019269010 7:135492-135514 TGTCACTTGGGGCATCCAGGTGG - Intergenic
1019446696 7:1074945-1074967 CACCACACGGGGCAGCCACCAGG - Intronic
1022230808 7:28410309-28410331 TGTCATTTGGGGCAGCGGCCGGG - Intronic
1022323653 7:29309999-29310021 TCTCTCATGGGGCAGGCACATGG + Intronic
1024325712 7:48107758-48107780 TGCCCCATGAGGCTGCCACCAGG + Intronic
1031972641 7:128075428-128075450 TTCCCCATGGGGCAGCCATCTGG + Intronic
1032794109 7:135263782-135263804 TGTCATGTGGGGCAGCCATCCGG + Intergenic
1034213509 7:149385127-149385149 GGTGACATGGGGCCGCCACCTGG - Intergenic
1034302994 7:150032453-150032475 GGTCACATGGCCCAGCCACTTGG - Intergenic
1034803053 7:154064815-154064837 GGTCACATGGCCCAGCCACTTGG + Intronic
1035375872 7:158406456-158406478 TGTCTCATGGATGAGCCACCGGG - Intronic
1035758447 8:2051511-2051533 GGTGACATGAGGCAGGCACCTGG - Intronic
1037539611 8:19858245-19858267 TGTCACATGGGGCAGCCATCTGG + Intergenic
1039950481 8:42167861-42167883 TGCCATATGGCGCAGGCACCAGG + Intronic
1040043526 8:42939759-42939781 TCTCAGATGGGGCAGCTGCCGGG + Intronic
1042864681 8:73346740-73346762 TGTAAAATGGTGCAGCCACACGG + Intergenic
1043521431 8:81049990-81050012 TGTCAAATGGGGCAGACTCGGGG - Intronic
1045277358 8:100720859-100720881 AGTCGCCTGGGGGAGCCACCAGG - Intronic
1046780386 8:118208734-118208756 TGTCAAATATGGTAGCCACCAGG - Intronic
1047835896 8:128690423-128690445 TGTAAAATGGCGCAGCCAACTGG - Intergenic
1050451569 9:5787095-5787117 TGTCACATGGAGTATCCACTGGG + Exonic
1050596938 9:7213479-7213501 TGTTGCATGGGGCAGGCACCTGG + Intergenic
1052459160 9:28741190-28741212 TGGAACATGGGGCAGCCACAGGG + Intergenic
1052597218 9:30575463-30575485 TGTTACGTGGGGCGGCCACCCGG - Intergenic
1053800239 9:41759433-41759455 GGTCTGCTGGGGCAGCCACCTGG + Intergenic
1054144957 9:61555402-61555424 AGTCTGCTGGGGCAGCCACCTGG - Intergenic
1054188667 9:61971585-61971607 GGTCTGCTGGGGCAGCCACCTGG + Intergenic
1054464650 9:65486359-65486381 GGTCTGCTGGGGCAGCCACCTGG - Intergenic
1054649854 9:67617032-67617054 GGTCTGCTGGGGCAGCCACCTGG - Intergenic
1056082144 9:83106549-83106571 TGTTACATGGGTCATCCACTTGG - Intergenic
1056138531 9:83651992-83652014 TGTAAAATGGGGCAGCTACTTGG - Intergenic
1056662704 9:88556248-88556270 TGTCACATGGGGAGGCCACCTGG + Intronic
1058399317 9:104595347-104595369 GGCCACATGGGGAAGCCACCAGG - Intergenic
1058722519 9:107776155-107776177 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1059466959 9:114475056-114475078 TGTAACATGGTGCAGACACTAGG + Intronic
1060032878 9:120230880-120230902 TGGCACATTGGACAGACACCTGG + Intergenic
1060064897 9:120495543-120495565 TCTCAGATGGGGCAGCTGCCGGG - Intronic
1061395640 9:130342152-130342174 GGCCCCATGGTGCAGCCACCAGG - Intronic
1061588826 9:131584999-131585021 GGTCACCTTGGGCAGCCACGAGG + Intronic
1061856897 9:133446760-133446782 TGTAAAATGGTGCAGCCACTGGG - Intronic
1062224271 9:135440544-135440566 TGTCAGATCGGGCAGCCCCAGGG + Intergenic
1062276978 9:135735892-135735914 TGTCACCTGGGCGAGTCACCTGG + Intronic
1062673427 9:137725008-137725030 TGTCACATGGGGCAGGCGTGTGG + Intronic
1187379751 X:18790030-18790052 TGTAAAATGGTGCAGCCACTTGG - Intronic
1191069004 X:56380362-56380384 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1191069014 X:56380402-56380424 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1193180027 X:78443429-78443451 TGTAAAATGGTGCAGCCACTTGG - Intergenic
1196456285 X:115893609-115893631 TGTCTCCTGGGGCAGCCCCATGG + Intergenic
1198087832 X:133297046-133297068 TATCACATGTGTCAGCCACCAGG + Intergenic
1200088288 X:153622202-153622224 TGTCAAACCGGGCAGCCACTCGG + Intergenic
1201383543 Y:13413350-13413372 TGTCACATGGGGCAGCCACCCGG - Intronic