ID: 1201384984

View in Genome Browser
Species Human (GRCh38)
Location Y:13430246-13430268
Sequence TTGCAAAAAAATGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2917
Summary {0: 1, 1: 15, 2: 253, 3: 703, 4: 1945}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201384984_1201384988 30 Left 1201384984 Y:13430246-13430268 CCCTCCTCCTCATTTTTTTGCAA 0: 1
1: 15
2: 253
3: 703
4: 1945
Right 1201384988 Y:13430299-13430321 TTTGTATGTTTGTCAGATTTTGG 0: 1
1: 1
2: 16
3: 220
4: 2396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201384984 Original CRISPR TTGCAAAAAAATGAGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr