ID: 1201385970

View in Genome Browser
Species Human (GRCh38)
Location Y:13439859-13439881
Sequence TCACCCATACCAACAAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201385967_1201385970 -8 Left 1201385967 Y:13439844-13439866 CCTAACTAGCCCAGTTCACCCAT 0: 1
1: 0
2: 1
3: 8
4: 119
Right 1201385970 Y:13439859-13439881 TCACCCATACCAACAAACCCAGG 0: 1
1: 0
2: 0
3: 7
4: 114
1201385966_1201385970 0 Left 1201385966 Y:13439836-13439858 CCAGTAGGCCTAACTAGCCCAGT 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1201385970 Y:13439859-13439881 TCACCCATACCAACAAACCCAGG 0: 1
1: 0
2: 0
3: 7
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201385970 Original CRISPR TCACCCATACCAACAAACCC AGG Intronic
901131977 1:6967557-6967579 TCAACCACACCAACATCCCCTGG - Intronic
902673026 1:17988147-17988169 TCATCCAAACCATCAAACACTGG - Intergenic
906578162 1:46909604-46909626 TCTCCCATTCCAACAACCTCAGG - Intergenic
907596849 1:55727905-55727927 ACACCCTCACCAACACACCCAGG - Intergenic
907596910 1:55728544-55728566 ACACCCTCACCAACACACCCAGG + Intergenic
907618670 1:55952850-55952872 ACACCCACACAGACAAACCCAGG - Intergenic
914354816 1:146875437-146875459 GCCCCCATACAAACAAACCCTGG + Intergenic
916923985 1:169498379-169498401 TCAACAATACTTACAAACCCTGG - Intergenic
917778148 1:178360830-178360852 CCACCCATACCTACAAACCAAGG - Intronic
918466657 1:184827679-184827701 TGATCAAAACCAACAAACCCGGG + Intronic
919693117 1:200545061-200545083 TCACCCAGACCAAAAATCCTAGG - Intergenic
923283271 1:232465614-232465636 ACAACAATAACAACAAACCCTGG - Intronic
1070985042 10:80681475-80681497 TAACCCATACCAAGAAACTAGGG + Intergenic
1074982535 10:118631313-118631335 ACACCCATACAGACACACCCCGG + Intergenic
1076698864 10:132259949-132259971 TCACCCATAACAGGAAACCATGG - Intronic
1079948668 11:26774152-26774174 TCACCCTCACAAACACACCCAGG + Intergenic
1083301453 11:61741562-61741584 GCACACAGACCCACAAACCCTGG + Intronic
1086099311 11:83082538-83082560 ACACCCTTACAGACAAACCCAGG + Intergenic
1087760768 11:102102133-102102155 TAACCCAGACCAACAAAATCAGG - Intergenic
1089157473 11:116413581-116413603 TCACGCAAACCAACAACACCTGG + Intergenic
1089165352 11:116471774-116471796 CCACCCATACCAACATCACCTGG + Intergenic
1096108676 12:49015383-49015405 TCTCCCATACCACCAAGCACAGG + Intronic
1097391767 12:59023948-59023970 TCACCCAAACCAAGAGGCCCTGG - Intergenic
1102418064 12:112781571-112781593 CCACCAATACCACCACACCCAGG - Intronic
1104233264 12:126906085-126906107 TCCCACATACCAACACACACAGG - Intergenic
1106812574 13:33374727-33374749 TGACCCATACAAACAAAGCATGG + Intergenic
1107132759 13:36913923-36913945 TCACCCATATCATCAATCACTGG + Intronic
1109327390 13:60884888-60884910 CCACCCATAACAACAAACATTGG + Intergenic
1111619612 13:90706773-90706795 ACACCCATACTGACACACCCAGG - Intergenic
1117972015 14:61261112-61261134 CCAAACAAACCAACAAACCCAGG + Intronic
1119191082 14:72682315-72682337 TGACCCATATCACCAAACACTGG - Intronic
1120307029 14:82783955-82783977 TCAACCATTCCAACAAAACAAGG - Intergenic
1130908112 15:88254057-88254079 TCACCCATTCCCAGAGACCCAGG + Intronic
1139979204 16:70840095-70840117 GCCCCCATACAAACAAACCCTGG - Exonic
1141285512 16:82668186-82668208 TCAACTACACCACCAAACCCTGG + Intronic
1148835926 17:50465739-50465761 TCGCCCTTACCAATAACCCCTGG - Exonic
1151340841 17:73469679-73469701 TCCCACATACACACAAACCCAGG - Intronic
1152996436 18:410905-410927 CCACCCATGCCAGCAAAGCCTGG + Intronic
1155070618 18:22312735-22312757 TCACCCCTACCAACTTTCCCTGG - Intergenic
1155881420 18:31153744-31153766 TCAACAACAACAACAAACCCTGG - Intronic
1159584379 18:70269644-70269666 ACACCCACACAGACAAACCCAGG - Intergenic
1159716902 18:71835349-71835371 ACACCCATACAGACACACCCAGG - Intergenic
1202632894 1_KI270706v1_random:16385-16407 CCACCCATGACAGCAAACCCAGG - Intergenic
925027411 2:620878-620900 TCACCCAAATCAAGAAACTCTGG - Intergenic
925906379 2:8542048-8542070 TCAGCCATTCCAACAAGGCCTGG + Intergenic
927867964 2:26604611-26604633 TCCCCCAGACAAACAAAACCTGG + Intronic
927902420 2:26830150-26830172 TCACCTTTACCAACATAACCTGG - Intergenic
928381529 2:30822426-30822448 TCATCCACACCAACCCACCCTGG + Intergenic
932883573 2:75527190-75527212 ACACCCACACCAGCAAAGCCTGG + Intronic
934939916 2:98493195-98493217 TCACCCTTTCCAAAAAACACAGG - Intronic
941631944 2:167894173-167894195 ACAGCAATAACAACAAACCCTGG - Intergenic
944099972 2:196014403-196014425 TCACCCAGACCATGAAACTCAGG + Intronic
944745436 2:202650939-202650961 ACACCCTCACAAACAAACCCGGG + Intronic
945351089 2:208781346-208781368 CCACCCCTGCCAACACACCCCGG - Intronic
947726507 2:232404654-232404676 CCACCCACAACACCAAACCCTGG + Intergenic
948274513 2:236697801-236697823 TAACCCCTCCCCACAAACCCCGG - Intergenic
1176645117 21:9342265-9342287 CCACCCATGACAGCAAACCCGGG - Intergenic
1177219124 21:18167849-18167871 ACACCCACACAGACAAACCCAGG - Intronic
1179636539 21:42714733-42714755 TCAACCATATCAACAAAGACTGG - Intronic
1179636558 21:42714869-42714891 TCAACCATATCAACAAAGACTGG - Intronic
1180367837 22:11956969-11956991 CCACCCATGACAGCAAACCCAGG + Intergenic
1183706749 22:39479038-39479060 CCACCTATCCCAACAGACCCAGG + Intronic
1185107479 22:48882587-48882609 TACCCCATACCCACAAACACAGG + Intergenic
1185211082 22:49570848-49570870 TAACCCTTTCCAACAGACCCAGG + Intronic
952257434 3:31707527-31707549 TGAGCCATACCAAAAAACCTTGG + Intronic
954322157 3:49839680-49839702 TCACCCACCCCACCAAAGCCAGG + Intronic
955791791 3:62595745-62595767 ACACCCACACAAACACACCCAGG - Intronic
957746805 3:84354302-84354324 TCAACCATACCCACCAACCTAGG - Intergenic
959187101 3:103058090-103058112 TCACCCATCCCAACAGGCCCTGG + Intergenic
963703847 3:148661048-148661070 TCACCCAGACATACAAACCTTGG + Intergenic
965517223 3:169634500-169634522 TCACCCTTACCAACAAGCCTTGG - Intronic
967209380 3:187153790-187153812 TCACCCCTAATAACAAAACCAGG + Intronic
968194524 3:196695426-196695448 ACACCCACACCCACAGACCCTGG + Intronic
1202741775 3_GL000221v1_random:62803-62825 CCACCCATGACAGCAAACCCGGG + Intergenic
968612095 4:1561885-1561907 TCACCCCTCCCAACAACCCACGG + Intergenic
970316775 4:14835547-14835569 TCATCCACAGTAACAAACCCAGG + Intergenic
971613444 4:28756973-28756995 ACACCCATACAGACACACCCAGG - Intergenic
975163747 4:71153340-71153362 ACACCCTTACCGACACACCCAGG + Intergenic
975497017 4:75046351-75046373 ACAACCATACCAACAAAACAGGG - Exonic
978387288 4:108188776-108188798 TCTCCCATACCACCAAGCCAAGG - Intergenic
979929402 4:126611792-126611814 TCACCCTTACAATCAAACCTTGG - Intergenic
986030501 5:3888860-3888882 TCATCCCTGCCAGCAAACCCAGG - Intergenic
987320547 5:16765179-16765201 TCACCCACACAGACACACCCAGG - Intronic
992059188 5:73025153-73025175 TCACCCATAGCAACTCAACCAGG - Intronic
992883385 5:81132732-81132754 GCACCCATACCCACAGAACCAGG + Intronic
993296514 5:86147911-86147933 ACACCCTTACAGACAAACCCAGG + Intergenic
996617171 5:125456050-125456072 TCCCCCCCACCAACAGACCCTGG + Intergenic
1001194310 5:169657719-169657741 TCACCCATTCAAACAAGACCTGG + Intronic
1005887501 6:30107947-30107969 TCATACATGCCAACAATCCCTGG - Intronic
1008167930 6:48163552-48163574 TCACCTTTACCAACAACCCAAGG - Intergenic
1011089522 6:83580581-83580603 TCACCTAGACCATCAAACACTGG + Exonic
1014498992 6:122163265-122163287 ACACCCATACAGACACACCCAGG + Intergenic
1019999259 7:4745437-4745459 ACACCCATACCCACCCACCCTGG - Intronic
1020697745 7:11436036-11436058 TCAACCATAATAACAAACCTTGG + Intronic
1021940113 7:25670646-25670668 TCACCTGTACAGACAAACCCAGG + Intergenic
1022383996 7:29884869-29884891 TAATCCTTAACAACAAACCCAGG - Intronic
1024547080 7:50531219-50531241 TCAGCCATCCCAGGAAACCCAGG + Intronic
1024615377 7:51107656-51107678 TCACCAGTACCAACATACCATGG + Intronic
1026080634 7:67215966-67215988 ACACCCATACAGACACACCCAGG + Intronic
1030825340 7:114149237-114149259 TCAAACAAACCAACCAACCCAGG - Intronic
1036275814 8:7350758-7350780 TCACCAATACAAGCATACCCTGG + Intergenic
1036840868 8:12120354-12120376 TCACCAATACAAGCATACCCTGG - Intergenic
1036888882 8:12581923-12581945 TCTCACTTACCAACACACCCTGG + Intergenic
1042643974 8:70965577-70965599 TCAACCAAACAAAAAAACCCAGG - Intergenic
1043544968 8:81305226-81305248 ACAACCATACTATCAAACCCAGG - Intergenic
1047414386 8:124652045-124652067 TCACCCATTTCAACCACCCCAGG + Intronic
1050188193 9:2997330-2997352 ACACCCACACAAACACACCCAGG - Intergenic
1050832522 9:10031301-10031323 ACACCCATACAGACACACCCAGG - Intronic
1051487097 9:17620754-17620776 TCACTCATACCAAGATACCTAGG - Intronic
1053299578 9:36939378-36939400 TAACCCAAACCACCAGACCCTGG + Intronic
1057547358 9:96028037-96028059 CCACCCATACCACCCAGCCCTGG + Intergenic
1057840419 9:98481592-98481614 TCAGCTCTACCAACAAACCATGG + Intronic
1059714276 9:116899147-116899169 TCACTGATACCCACAAAGCCAGG - Intronic
1060478359 9:124001271-124001293 ACACACACACCAACAATCCCAGG - Intergenic
1060492991 9:124098615-124098637 TCACCCACAACATCAAACCCAGG - Intergenic
1061194916 9:129102366-129102388 CCACCCACACCTACAAGCCCCGG - Intronic
1062009341 9:134258862-134258884 TCACCCAGAGCACCCAACCCAGG - Intergenic
1186045136 X:5527693-5527715 TCCCACATACCCATAAACCCAGG - Intergenic
1191658913 X:63630754-63630776 ACACCCATACAGACACACCCAGG + Intergenic
1196293507 X:113972930-113972952 ACAGCAAGACCAACAAACCCTGG - Intergenic
1200268321 X:154658536-154658558 TCACCCCTACCACCAAACCTAGG - Intergenic
1201385970 Y:13439859-13439881 TCACCCATACCAACAAACCCAGG + Intronic