ID: 1201387624

View in Genome Browser
Species Human (GRCh38)
Location Y:13459766-13459788
Sequence AAGGACAACTTCAGCCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 316}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201387624_1201387628 15 Left 1201387624 Y:13459766-13459788 CCTCAGTGGCTGAAGTTGTCCTT 0: 1
1: 0
2: 0
3: 25
4: 316
Right 1201387628 Y:13459804-13459826 AAACCTTTTAATATTATTATAGG 0: 1
1: 0
2: 2
3: 68
4: 680

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201387624 Original CRISPR AAGGACAACTTCAGCCACTG AGG (reversed) Intronic
903657583 1:24958784-24958806 TGGGACACCTGCAGCCACTGGGG - Intronic
907677216 1:56529426-56529448 AAGAACAACTTGACCCTCTGTGG - Intronic
907761604 1:57367183-57367205 GAGGACCACTTCAGCCAGGGAGG + Intronic
908411059 1:63866006-63866028 AAGGAAAATTTCAGCAATTGGGG - Intronic
909571107 1:77111577-77111599 AAGGAGAACATCACACACTGGGG + Intronic
910274858 1:85438148-85438170 AAGGGCAACAACAGACACTGGGG + Intronic
911544463 1:99200102-99200124 AAGGAGAACATCACACACTGGGG - Intergenic
912083584 1:105971097-105971119 AAGGGGAACATCAGACACTGGGG + Intergenic
913570881 1:120118975-120118997 AAGGACAACTTAACCCATTGGGG - Intergenic
914291686 1:146279951-146279973 AAGGACAACTTAACCCATTGGGG - Intergenic
914324960 1:146603821-146603843 AAGGAGAACATCACACACTGGGG - Intergenic
914552730 1:148730734-148730756 AAGGACAACTTAACCCATTGGGG - Intergenic
916597448 1:166257957-166257979 AAGGCCTACTTCAACCCCTGAGG - Intergenic
916950750 1:169777973-169777995 AAGGGGAACATCACCCACTGGGG + Intronic
917092327 1:171365818-171365840 AAGGAGAACATCACACACTGGGG + Intergenic
919112729 1:193241292-193241314 AAGCAAACCTTAAGCCACTGAGG - Intronic
919229721 1:194758390-194758412 AAGGGCAACATCACACACTGGGG + Intergenic
919268121 1:195300583-195300605 AAATATAACTTCAGCTACTGAGG + Intergenic
921080748 1:211736977-211736999 ATGGACAACTGCAGTCAGTGAGG + Intergenic
921406553 1:214786140-214786162 TAGGAGAACATCACCCACTGGGG - Intergenic
921879648 1:220240558-220240580 AAAGAAAATTTCAGCAACTGAGG - Intronic
922860786 1:228814507-228814529 ATGGAAAGCTTCAGACACTGAGG - Intergenic
923365057 1:233251566-233251588 AATGACAACCGCAGCCCCTGTGG + Intronic
1063484500 10:6406435-6406457 AATCACAATTTTAGCCACTGGGG - Intergenic
1064342104 10:14496590-14496612 AAAGGCAAGTTCAACCACTGTGG + Intergenic
1064483340 10:15761254-15761276 AAGGAGAACATCACACACTGGGG - Intergenic
1064577981 10:16765466-16765488 AAGGTGAAAATCAGCCACTGGGG + Intronic
1065906265 10:30255251-30255273 GAGGAGAACAGCAGCCACTGTGG - Intergenic
1067775680 10:49163244-49163266 TGTGACAACTTCAGCCAATGTGG + Intronic
1068308986 10:55255123-55255145 AAGGGGAACATCACCCACTGGGG - Intronic
1068366728 10:56060527-56060549 AAGGAGAACATCACACACTGGGG - Intergenic
1068378106 10:56211479-56211501 AAGGAGAACATCACTCACTGGGG + Intergenic
1068777013 10:60878747-60878769 ATGGACAACTACAGGCACTCAGG - Intronic
1068846206 10:61677716-61677738 AAGGAGAACATCACACACTGGGG - Intronic
1069393042 10:67957327-67957349 TAGGGCAACTGCAGCAACTGAGG + Intronic
1070873162 10:79776401-79776423 AAGTATAAATTCAGGCACTGGGG + Intergenic
1072053711 10:91731975-91731997 AAGGGCAACATCACACACTGGGG - Intergenic
1073368867 10:102968691-102968713 AAGGATCACTTGAGCCACAGAGG - Intronic
1073735872 10:106345574-106345596 AAGTTCAACTTCAGCATCTGTGG - Intergenic
1074891657 10:117741118-117741140 CAGCACAGCTTCAGCCTCTGGGG - Intergenic
1074999058 10:118782003-118782025 AAGGACAACTTAAGCAACAGAGG + Intergenic
1075222688 10:120598741-120598763 AGGGACACCTTCCGACACTGGGG + Exonic
1075363086 10:121857512-121857534 ATGGGCTAGTTCAGCCACTGTGG + Intronic
1075773620 10:124962873-124962895 AAGGACAGCTGAAGCCACTCTGG - Intronic
1076485709 10:130815434-130815456 CAGTCAAACTTCAGCCACTGAGG + Intergenic
1076549764 10:131270909-131270931 AGGCACGACTTCAGCCAGTGTGG - Intronic
1077791526 11:5446075-5446097 AAGGGGAACATCAGCCACTGGGG + Intronic
1077945834 11:6897106-6897128 AAGGACCACTGTAGGCACTGGGG - Intergenic
1078035716 11:7802794-7802816 AAGGAGAACAACAGACACTGGGG + Intergenic
1078036128 11:7806716-7806738 AACTACACCTTGAGCCACTGAGG + Intergenic
1078039710 11:7848719-7848741 GAGGACAAATTCGGTCACTGTGG - Intergenic
1079355616 11:19727991-19728013 AATGACTACTCCAGCCACTCTGG + Intronic
1079982940 11:27170735-27170757 AAGGGGAACTTCACACACTGGGG - Intergenic
1081672176 11:44948651-44948673 AGGGACAGTTTCAGGCACTGGGG - Intronic
1081700404 11:45148903-45148925 ATGGACACCTTTGGCCACTGTGG - Intronic
1082111917 11:48286346-48286368 AAGGAGAACATCACACACTGTGG - Intergenic
1082311132 11:50649907-50649929 AAGGAGAACATCACACACTGGGG + Intergenic
1084646277 11:70460458-70460480 GGGGACCACTGCAGCCACTGTGG - Intergenic
1084872895 11:72109763-72109785 AAGGGCACTTTCAGGCACTGGGG + Exonic
1085495958 11:76969765-76969787 AAGGGGAACATCAGACACTGGGG + Intronic
1087313380 11:96577140-96577162 ATGCACAAGCTCAGCCACTGTGG - Intergenic
1087366611 11:97227711-97227733 AAGGGGAACTTCACACACTGGGG - Intergenic
1088267712 11:108003429-108003451 AAAGACATATTCAGCCACTCGGG - Intergenic
1089033182 11:115355434-115355456 AAGGAGAACAACAGACACTGGGG + Intronic
1089747246 11:120625972-120625994 AAGGCCAACTTCATCTGCTGAGG + Intronic
1089753789 11:120670876-120670898 AAGGGGAACATCAGACACTGGGG - Intronic
1090154650 11:124424830-124424852 AAGGATAAACTCAGTCACTGAGG + Exonic
1092239429 12:6828108-6828130 AAGGATGACTTCAGCCCCAGCGG - Intronic
1093372260 12:18379334-18379356 AAGGAGAACATCACACACTGGGG + Intronic
1094764736 12:33579808-33579830 AAGGGGAACAACAGCCACTGAGG + Intergenic
1095522184 12:43080246-43080268 GAGGACAAATTGACCCACTGTGG - Intergenic
1098180202 12:67839671-67839693 AACCACAACCTAAGCCACTGAGG - Intergenic
1099484262 12:83208744-83208766 AAGGGGAACATCACCCACTGGGG - Intergenic
1099753338 12:86806826-86806848 AAGGAGAACATCACACACTGGGG + Intronic
1099846831 12:88037397-88037419 AAGGACAACACGAGACACTGAGG - Intronic
1100174626 12:92015409-92015431 AAGGAGAACATCACACACTGAGG - Intronic
1101346759 12:103892967-103892989 AAGGGCAAATTCAGACACTGTGG - Intergenic
1101761852 12:107665177-107665199 AAGGAGAACATCAGACACTGGGG + Intergenic
1102745723 12:115247324-115247346 AAGGAGAACATCACACACTGGGG + Intergenic
1105346624 13:19578821-19578843 AAGGGGAACATCACCCACTGGGG + Intergenic
1105533100 13:21237706-21237728 AAGGAAAACTTCAGGAGCTGAGG - Intergenic
1106304330 13:28496117-28496139 CAGGACGACTTCAGCCTTTGAGG - Intergenic
1106347949 13:28897870-28897892 AAGGGGAACATCACCCACTGGGG + Intronic
1107733236 13:43369794-43369816 CAGGACAGATTCAGCCACAGAGG + Intronic
1108218237 13:48206827-48206849 AAGGGCAACATCACACACTGGGG + Intergenic
1108263532 13:48681524-48681546 AAGGACCTCTTAAGCAACTGGGG - Intronic
1108340195 13:49491796-49491818 AAGGAAATCTTCTGCCAATGTGG + Exonic
1110274468 13:73628267-73628289 AAGGAGAACATCACACACTGGGG - Intergenic
1111572257 13:90104188-90104210 AACCACACCTTCAGTCACTGAGG - Intergenic
1112436654 13:99395419-99395441 AAGGCCAACTTCACCTTCTGAGG - Intergenic
1112666470 13:101580610-101580632 AAGGAGAACATCACACACTGGGG - Intronic
1117605726 14:57426902-57426924 AATGATTAGTTCAGCCACTGTGG + Intergenic
1117846188 14:59914083-59914105 AAGGAGAACATCACACACTGGGG - Intergenic
1118106061 14:62661017-62661039 AGGGACAATTTCAGCCAAGGAGG + Intergenic
1119925458 14:78489351-78489373 AAGGCCAACGTCAACCACTTTGG - Intronic
1202846943 14_GL000009v2_random:186381-186403 AAGAGCAACTTCAGCTATTGAGG - Intergenic
1202916403 14_GL000194v1_random:176982-177004 AAGAGCAACTTCAGCTATTGAGG - Intergenic
1202876381 14_KI270722v1_random:6129-6151 AAGAGCAACTTCAGCTATTGAGG + Intergenic
1124752308 15:32380939-32380961 AAGGAGAACATCACACACTGGGG + Intergenic
1125275966 15:37992817-37992839 AAGGGGAACATCAGACACTGGGG + Intergenic
1125633315 15:41166401-41166423 CAGGACAAGTTCACACACTGGGG + Intergenic
1127975064 15:63990976-63990998 AAGGACAGGGTCAGCCACAGAGG - Intronic
1129261279 15:74369062-74369084 AAGGACAACTTTTGCCATTGTGG - Intergenic
1129632112 15:77271751-77271773 AAGGAGAACATCACACACTGCGG + Intronic
1131025743 15:89140042-89140064 AAGGGACTCTTCAGCCACTGAGG - Intronic
1131818563 15:96247745-96247767 ATGTACAATTTCAGCCACTGTGG - Intergenic
1132255313 15:100372020-100372042 AAAAACTAGTTCAGCCACTGTGG - Intergenic
1133647854 16:7781130-7781152 GTGGACAACTGCAGGCACTGTGG - Intergenic
1133962265 16:10504863-10504885 AAGTCCAACCTCAGCCAATGGGG + Intergenic
1134759045 16:16697240-16697262 GAGGAGAAATTCAGTCACTGAGG + Intergenic
1134987029 16:18661944-18661966 GAGGAGAAATTCAGTCACTGAGG - Intergenic
1135483747 16:22845231-22845253 CAGTACAACTTCATCCACTAAGG + Intronic
1140008602 16:71107125-71107147 AAGGAGAACATCACACACTGGGG + Intronic
1140340728 16:74157448-74157470 AAGGAGAACATCACACACTGGGG + Intergenic
1141485007 16:84333166-84333188 GAGGAAGACTGCAGCCACTGGGG + Intergenic
1141853382 16:86664086-86664108 AAAGCCAACTTCAGACGCTGAGG + Intergenic
1142223152 16:88865076-88865098 GAGGCCCACTTCAGCCGCTGTGG - Exonic
1142960246 17:3548051-3548073 CAGGACAACTGCAGCCTCTGTGG + Intronic
1144831024 17:18131293-18131315 AACGACAACTCCAGCCGCTTTGG + Exonic
1145776420 17:27532202-27532224 AAGGACCACGTCAACCAGTGAGG - Intronic
1147407185 17:40220483-40220505 AAGGACCACTTCAGCCCGGGAGG - Intronic
1150315502 17:64165557-64165579 GAGGGCAGCTACAGCCACTGGGG - Intronic
1150534372 17:66020920-66020942 AAAGAAAACTTCAGATACTGGGG + Intronic
1152543198 17:80987374-80987396 CAGGGCAACTTCCTCCACTGCGG + Intergenic
1153115184 18:1646290-1646312 AAGGAGAACATCACACACTGGGG + Intergenic
1153783178 18:8512180-8512202 CAGGTCAGCTTCAGCCTCTGGGG - Intergenic
1155283026 18:24260221-24260243 ATGTAAAACGTCAGCCACTGCGG + Intronic
1155657256 18:28206639-28206661 AAGGAGAACAACAGACACTGGGG - Intergenic
1155845995 18:30707561-30707583 AAGAACCACTTCTGCCACTGTGG - Intergenic
1155938026 18:31774594-31774616 ACGAAGACCTTCAGCCACTGTGG - Intergenic
1158175904 18:54655418-54655440 AAGGACCACTTAAGCCAGGGAGG - Intergenic
1158207966 18:55014699-55014721 ACACACAACTTCTGCCACTGGGG - Intergenic
1159400093 18:67919944-67919966 AAAGAAAACTACAGACACTGGGG - Intergenic
1159620347 18:70630133-70630155 AAGGGGAACTTCACACACTGGGG + Intergenic
1159974122 18:74689705-74689727 ATGGGCAACTTCAGCTCCTGAGG - Intronic
1160633026 18:80259667-80259689 AAGGAAAACTATAGCCATTGTGG - Intergenic
1162123579 19:8487054-8487076 AAGGACAAATTCAACGAGTGCGG + Exonic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
1163688831 19:18727292-18727314 AAGGACAAGGTCAGGCACGGTGG + Intronic
1163880599 19:19918121-19918143 AAGGAGAACATCACACACTGGGG - Intronic
1164984168 19:32636144-32636166 AAGGACGCCTTCATCCACGGTGG + Intronic
1165170485 19:33888507-33888529 AGGGTCAACTCCAGGCACTGAGG + Intergenic
1166053825 19:40276931-40276953 GAGGACCACTTGAGCCAGTGAGG + Intronic
1166262755 19:41652709-41652731 CAGCACATCCTCAGCCACTGAGG + Intronic
924958597 2:12705-12727 AAGGAAAACTACAGCCATTGTGG + Intergenic
924973330 2:151224-151246 AATGACAACTTTTGCCACTGAGG - Intergenic
926089036 2:10038148-10038170 AAGGCCGAGTGCAGCCACTGAGG + Intergenic
926694517 2:15761815-15761837 AGTGACAACTTCTGGCACTGAGG - Intergenic
926742646 2:16125459-16125481 AAAGACAAATTCAGCATCTGAGG + Intergenic
929732786 2:44513692-44513714 AAGGACATCTTCAATCACTATGG + Intronic
930772832 2:55144859-55144881 AAGGACAACATCAAGCCCTGAGG + Intergenic
931815428 2:65896210-65896232 GAGGAGAACATCAACCACTGGGG + Intergenic
931911851 2:66908548-66908570 AAGGGCAACGTCACACACTGGGG - Intergenic
932732636 2:74231947-74231969 AAGTACATCTTCAGCCCCTTAGG - Intronic
933222644 2:79708214-79708236 AAGGGCAACTTGAACTACTGGGG - Intronic
935106981 2:100053974-100053996 ATGGAGAACTGCAGCCATTGGGG - Intronic
936976374 2:118225480-118225502 AAGGACACCTTCAGCTTCTGGGG - Intergenic
937739165 2:125329115-125329137 AAGGGAAACTTCAGCCAGTGTGG + Intergenic
940381950 2:153025117-153025139 AATGAGAAAATCAGCCACTGTGG - Intergenic
941322108 2:164068738-164068760 AATGATTACTTCAGCCACTTAGG - Intergenic
944198701 2:197082766-197082788 AAGAACAATTTCATCAACTGTGG + Intronic
947021024 2:225675728-225675750 AAAAACTAGTTCAGCCACTGTGG - Intergenic
947381049 2:229545620-229545642 AAGGACCACAGCAGTCACTGAGG - Intronic
947640723 2:231706563-231706585 AATGCCACCTCCAGCCACTGGGG + Intergenic
947747290 2:232515132-232515154 AAGGCCAAGTTCAGCCCATGGGG + Intergenic
947946441 2:234107183-234107205 AAGGAGAACATCACACACTGGGG + Intergenic
1170437014 20:16340792-16340814 AAGGACCACTGGGGCCACTGTGG - Intronic
1170580281 20:17693967-17693989 ACGGATTCCTTCAGCCACTGGGG + Intronic
1171570458 20:26245224-26245246 AAGGGCAACATCACACACTGGGG + Intergenic
1173846725 20:46193136-46193158 AGGGACCAGCTCAGCCACTGGGG - Intronic
1176635756 21:9191628-9191650 AAGAGCAACTTCAGCTATTGAGG - Intergenic
1176637645 21:9263499-9263521 AAGAGCAACTTCAGCTATTGAGG + Intergenic
1179287552 21:39991133-39991155 AAGGCCAGCGTCAGCCACCGAGG - Intergenic
1180371319 22:12039906-12039928 AAGAGCAACTTCAGCTACTGAGG - Intergenic
1180414365 22:12694828-12694850 AAGAGCAACTTCAGCTATTGAGG + Intergenic
1181035494 22:20168063-20168085 TTGGACAACCCCAGCCACTGGGG - Intergenic
1181376069 22:22459250-22459272 CAGTACAACTCCAGCCAATGGGG + Intergenic
1181617793 22:24066488-24066510 AAGGCCACTTTCAGCCAGTGTGG - Intronic
1183297324 22:37037900-37037922 CAGGACAGCTGCAGCCTCTGGGG - Intergenic
1184764240 22:46563437-46563459 GAGGACAAATGCAGCCAGTGTGG + Intergenic
1185222365 22:49635512-49635534 AAGGAAAACTTTACCCAGTGGGG - Intronic
949268958 3:2191900-2191922 AAGGGGAACATCAGACACTGGGG - Intronic
951636376 3:24782709-24782731 GAGGAAAACAGCAGCCACTGTGG - Intergenic
952066440 3:29576973-29576995 AGGTACCAGTTCAGCCACTGTGG - Intronic
953331464 3:42057034-42057056 AAGGGCACCTTCTGCCACTTTGG + Intronic
955650664 3:61190901-61190923 AAGGGGAACATCACCCACTGGGG + Intronic
955651992 3:61204992-61205014 AAGGAGAACATCACACACTGGGG - Intronic
956255800 3:67282222-67282244 AAGGAGAACATCACCCACTGGGG + Intergenic
957079885 3:75628208-75628230 AAGGAAAACTATAGCCATTGTGG + Intergenic
957836165 3:85592875-85592897 AAGGGGAACATCACCCACTGGGG - Intronic
957925452 3:86805178-86805200 AAGGACAAGCTTAGCCACAGTGG + Intergenic
958176475 3:90001920-90001942 AAGGGGAACATCACCCACTGGGG + Intergenic
959191744 3:103121358-103121380 AAGGAGAACATCACACACTGGGG + Intergenic
962075067 3:132072998-132073020 AAGGGGAACATCAGACACTGGGG + Intronic
963316266 3:143762161-143762183 AAGGGGAACATCACCCACTGGGG + Intronic
964530520 3:157662947-157662969 AAGGAGAACATCACACACTGGGG - Intronic
965238153 3:166155895-166155917 AAGGAAAACATCACACACTGGGG - Intergenic
1202749250 3_GL000221v1_random:141522-141544 AAGAGCAACTTCAGCTATTGAGG - Intergenic
968373529 4:17614-17636 AAGGAAAACTACAGCCTTTGTGG + Intergenic
970590719 4:17558132-17558154 AAGGCCAACAACAGACACTGGGG + Intergenic
971442261 4:26699833-26699855 AAGGGGAACTTCACGCACTGGGG + Intronic
972829105 4:42793531-42793553 AAGGGCAACATCACACACTGGGG + Intergenic
972991299 4:44824859-44824881 AAGGAGAACATCACACACTGGGG + Intergenic
973323610 4:48834794-48834816 AAGGGCAACTTAAGCCATTAAGG + Intronic
973775773 4:54239938-54239960 AAGGATCACTTGAGCCAGTGAGG - Intronic
974643963 4:64669510-64669532 AAGGGCAACATCACACACTGGGG + Intergenic
975296131 4:72736557-72736579 AAGGAGAACATCACACACTGGGG + Intergenic
975378212 4:73669675-73669697 AGTGACAGCTTCAGCCAATGGGG + Intergenic
975519438 4:75283804-75283826 AATGACAAAATCAGCAACTGGGG + Intergenic
976882787 4:89949194-89949216 AAGGAGAACTTAAGAAACTGTGG - Intronic
977081936 4:92541113-92541135 AAGGAGAACATCACACACTGGGG + Intronic
978623394 4:110657026-110657048 AGGGAGAACTTCAGCCAGGGTGG + Intergenic
978923608 4:114216849-114216871 GGGCACAACTTCAGCCAGTGTGG + Intergenic
979385627 4:120062457-120062479 AAGGAAAATTTGAGCCACTCAGG + Intronic
980254586 4:130362321-130362343 TAGCACAGCTGCAGCCACTGAGG + Intergenic
980635630 4:135498251-135498273 AAGGAGAACCACAGACACTGGGG - Intergenic
981262533 4:142738429-142738451 AAGGAGAACATCACACACTGGGG + Intronic
981337998 4:143588414-143588436 AAGGAGAACATCACACACTGGGG - Intronic
981384496 4:144112900-144112922 AAGGACATCTTGATGCACTGTGG + Intronic
981661222 4:147168983-147169005 AAGGAGAACATCACACACTGGGG + Intergenic
983176031 4:164588822-164588844 AAGGAGAACATCACACACTGGGG + Intergenic
983815612 4:172122718-172122740 AAGGCCAAGTGCAGCCACTGTGG + Intronic
984222487 4:176994945-176994967 GAGGATAACTTCAGCCCCAGAGG - Intergenic
984665380 4:182421848-182421870 AAGGGCCATTTCAGCCCCTGAGG - Intronic
985461864 4:190114937-190114959 AAGGAAAACTACAGCCTTTGTGG - Intergenic
1202752544 4_GL000008v2_random:21915-21937 AAGAGCAACTTCAGCTATTGAGG + Intergenic
985950897 5:3220645-3220667 AATGCCAACGTCAGCCAATGTGG + Intergenic
987009465 5:13747059-13747081 AAGGGGAACTTCACACACTGGGG - Intronic
987560019 5:19507725-19507747 AAGGGGAACTTCACACACTGGGG + Intronic
987720987 5:21632364-21632386 AAGGAAAACAGCAGACACTGAGG - Intergenic
988082166 5:26428303-26428325 AAGGAGAACATCACACACTGAGG - Intergenic
989041535 5:37233930-37233952 AACTACACCTTAAGCCACTGAGG + Intronic
990047321 5:51449325-51449347 AAGAAGAAAATCAGCCACTGGGG + Intergenic
990400308 5:55430440-55430462 AACTGCAACTTAAGCCACTGAGG + Intronic
990507374 5:56457909-56457931 CAGCACAACCTTAGCCACTGTGG - Exonic
990676679 5:58194392-58194414 AAGGGGAACATCAGACACTGGGG + Intergenic
991140051 5:63230118-63230140 AAGGAGAACATCACACACTGGGG - Intergenic
991952271 5:71957792-71957814 AAGGGAAACTTCACACACTGGGG + Intergenic
992012627 5:72544385-72544407 AAGGGGAACATCAGACACTGGGG - Intergenic
992555105 5:77895477-77895499 AAGGACCACTTCAGCCCAGGAGG + Intergenic
993675981 5:90816582-90816604 AAGGGGAACATCACCCACTGGGG - Intronic
993689770 5:90985631-90985653 AAGCAGAGCTTCAGACACTGTGG - Intronic
993944888 5:94106529-94106551 AATGTAAATTTCAGCCACTGTGG + Intronic
995714619 5:115069803-115069825 AAGGAGATCTTCTGCCAATGAGG - Intergenic
996320517 5:122210363-122210385 AAGGGGAACATCACCCACTGGGG + Intergenic
996584487 5:125069579-125069601 AATGACAACATCAGACACTAGGG - Intergenic
997430740 5:133838959-133838981 AAGGACAACTGGAGCCATTGTGG - Intergenic
997811255 5:136972880-136972902 AAGGACCACTTCAGCCTGGGAGG - Intergenic
998722702 5:144972847-144972869 AAGGGGAACATCAGACACTGGGG - Intergenic
999145623 5:149391369-149391391 ATGGAGAACCTCAGCCACGGGGG + Intronic
1003171451 6:3724673-3724695 AGGGCCACCTTCAGTCACTGGGG - Intronic
1003393449 6:5732883-5732905 AAGGAAGAATTCAGCAACTGTGG - Intronic
1004216689 6:13710970-13710992 AAGGACAAGTTCAGCTACATCGG - Exonic
1004529090 6:16436981-16437003 AAGGACAACGTCAACAACTGTGG + Intronic
1005200503 6:23339336-23339358 AAGCACATCTTCAGCCCCTGTGG - Intergenic
1005267826 6:24131345-24131367 AAGAACAACTTCAGCATCTAAGG + Intronic
1005800473 6:29417293-29417315 AAGGAGAAATTCAGTGACTGAGG - Intronic
1006820608 6:36891164-36891186 AAGGGCAACATCACACACTGGGG - Intronic
1007769868 6:44183900-44183922 ATGGTCATCTGCAGCCACTGTGG - Exonic
1010477930 6:76312293-76312315 AAGGACAACAACACACACTGGGG - Intergenic
1011876799 6:91971868-91971890 AAGGAGAACATCACACACTGGGG - Intergenic
1012063769 6:94520273-94520295 AACTAAATCTTCAGCCACTGAGG + Intergenic
1013108756 6:107048459-107048481 AATGACTACTTCAGCCTATGTGG - Intronic
1014644083 6:123953168-123953190 AACCACACCTTAAGCCACTGAGG - Intronic
1014765570 6:125402052-125402074 AAGGAGAACATCACACACTGGGG + Intergenic
1014841121 6:126221345-126221367 AATGTAAAGTTCAGCCACTGTGG - Intergenic
1014988285 6:128040234-128040256 TCTGACAAGTTCAGCCACTGTGG - Intronic
1016212546 6:141556357-141556379 AATGACAACTTCTCACACTGAGG + Intergenic
1016351068 6:143168428-143168450 AAGGAGAACATCACACACTGGGG - Intronic
1016567751 6:145475433-145475455 GAGGACAACATCACACACTGGGG + Intergenic
1016639387 6:146331662-146331684 AAGGTCAATTTCATCCTCTGTGG + Intronic
1017974095 6:159338812-159338834 AAAGTCACCTTAAGCCACTGAGG + Intergenic
1019864278 7:3690999-3691021 AAGGACAAAATCAACCAGTGAGG - Intronic
1021398548 7:20182161-20182183 AAGGGGAACATCACCCACTGGGG + Intronic
1023328144 7:39082719-39082741 AATCACAGCTGCAGCCACTGGGG - Intronic
1023397962 7:39769228-39769250 AAGGACAACATCACACACTGGGG - Intergenic
1023436402 7:40144527-40144549 AAGGAAAACTCCAGCCACCCTGG - Intronic
1023837889 7:44079217-44079239 AAGGACAACTAAACACACTGGGG + Intronic
1026182101 7:68050505-68050527 AAGGATCACTTCAGCCAAGGAGG + Intergenic
1027930188 7:84522324-84522346 AAGGGGAACATCACCCACTGGGG + Intergenic
1029927735 7:104335319-104335341 AAGGATACCTACAGCCAGTGAGG + Intronic
1030156677 7:106462271-106462293 AGGGACAACTTCCACCACTGAGG - Intergenic
1030779009 7:113574101-113574123 AAGGGGAACATCACCCACTGGGG + Intergenic
1030821700 7:114100315-114100337 AAGGAAAACTTCAGCAAATATGG - Intronic
1031117990 7:117688964-117688986 AAGGATACCTTCATCCATTGTGG + Intronic
1031259638 7:119502314-119502336 AAGGAGAACATCACACACTGGGG - Intergenic
1036978590 8:13443174-13443196 AAGGGAAACATCAGACACTGGGG + Intronic
1040063722 8:43127562-43127584 AATGGCAACTTAAGCCACTGAGG - Intergenic
1041661729 8:60407549-60407571 AAGGAAACCACCAGCCACTGTGG - Intergenic
1041749872 8:61249085-61249107 AAGGAGAACATCACACACTGGGG - Intronic
1043337081 8:79189438-79189460 AAGGAAAACAGCAGACACTGGGG + Intergenic
1043386330 8:79751424-79751446 AAGAAGAACTACAGCTACTGTGG + Intergenic
1043492316 8:80762005-80762027 AAGGACATCTTCATTTACTGAGG + Intronic
1044318113 8:90772991-90773013 AAGGAGAACATCACACACTGGGG + Intronic
1046449557 8:114370783-114370805 AAGGAGAACAACAGACACTGGGG + Intergenic
1049489069 8:142883322-142883344 AAGGACAACATCACACTCTGGGG + Intronic
1050706248 9:8401723-8401745 AAAGACAACATCAATCACTGCGG + Intronic
1052017697 9:23488449-23488471 AAGGAGAACTACAGACACTGGGG - Intergenic
1054942928 9:70763419-70763441 GAGGACCACTTCAGCCAGGGAGG + Intronic
1055859079 9:80726836-80726858 AAGGAGAACATCACACACTGGGG - Intergenic
1056045661 9:82713138-82713160 AATGACAACTTCAAAGACTGTGG - Intergenic
1058403621 9:104645504-104645526 AAGGGGAACATCAGACACTGGGG - Intergenic
1060263814 9:122097945-122097967 AATGACAGCTTCAGCCGCTTAGG + Intergenic
1060790398 9:126482081-126482103 AAGGCCAACTTCAGACTGTGAGG + Intronic
1062334240 9:136058081-136058103 AAACACTACATCAGCCACTGGGG + Intronic
1203758532 Un_GL000218v1:158936-158958 AAGAGCAACTTCAGCTATTGAGG - Intergenic
1203717888 Un_KI270742v1:171612-171634 AAGAGCAACTTCAGCTATTGAGG - Intergenic
1203533331 Un_KI270743v1:6618-6640 AAGAGCAACTTCAGCTATTGAGG + Intergenic
1203652110 Un_KI270751v1:135198-135220 AAGAGCAACTTCAGCTATTGAGG - Intergenic
1185617698 X:1433332-1433354 AACGACATCATCCGCCACTGGGG - Intronic
1185711600 X:2308218-2308240 AAGTACAGCTTCAGCCAACGAGG + Intronic
1186094197 X:6082246-6082268 AAGGATAACGTCAGACACAGGGG + Intronic
1186139074 X:6552167-6552189 AACGACGACTTTAGACACTGAGG + Intergenic
1186362437 X:8856544-8856566 AAGGGCACTTTCAGGCACTGGGG + Intergenic
1188230779 X:27660538-27660560 AACCACACCTTGAGCCACTGAGG - Intronic
1188289439 X:28369527-28369549 GAGGACAACAACAGACACTGGGG - Intergenic
1188385663 X:29554422-29554444 GAGAACAGATTCAGCCACTGTGG - Intronic
1190524457 X:51314335-51314357 AAGGGCAACATCACACACTGGGG + Intergenic
1190637131 X:52446328-52446350 AAGGAGAGCTTCTTCCACTGTGG + Intergenic
1190995169 X:55600703-55600725 AAGGAGAACATCACACACTGGGG - Intergenic
1191185753 X:57610006-57610028 AAGGGGAACATCAGACACTGGGG - Intergenic
1192104306 X:68298893-68298915 TTGGACATCTTCATCCACTGTGG - Intronic
1193031314 X:76901265-76901287 AAGGGGAACTTCACACACTGGGG + Intergenic
1193556016 X:82953983-82954005 AATCACAACTTAAGCCAATGAGG + Intergenic
1193566534 X:83083841-83083863 AAGGAGAACATCACACACTGGGG - Intergenic
1193707478 X:84839842-84839864 GAGGAGAACTACAGACACTGGGG + Intergenic
1194222984 X:91219124-91219146 AAGGAGAACATCACACACTGGGG - Intergenic
1195318191 X:103699209-103699231 TAGGCCAACTTAAGCCACTTGGG + Intergenic
1196135129 X:112200607-112200629 AAGGACAGGTTCAGGTACTGGGG + Intergenic
1197767177 X:130066862-130066884 GAGCTCAAGTTCAGCCACTGGGG + Exonic
1198997132 X:142586012-142586034 AAGGGGAACATCACCCACTGGGG + Intergenic
1199223153 X:145340520-145340542 AAGGACCAGCTCAGCCACAGTGG + Intergenic
1200559462 Y:4682579-4682601 AAGGAGAACATCACACACTGGGG - Intergenic
1200778282 Y:7190189-7190211 AAGGGCAACATCACACACTGGGG - Intergenic
1201073828 Y:10171984-10172006 TGGGACAACTTGAGCCACTCAGG - Intergenic
1201387624 Y:13459766-13459788 AAGGACAACTTCAGCCACTGAGG - Intronic
1201626320 Y:16018603-16018625 AAGGGTAACTTCACACACTGGGG - Intergenic
1202022750 Y:20483013-20483035 AAGGGGAACATCAGACACTGGGG + Intergenic
1202271995 Y:23081798-23081820 CAGGAAAACTTCATCCTCTGGGG + Intergenic
1202294031 Y:23338884-23338906 CAGGAAAACTTCATCCTCTGGGG - Intergenic
1202424992 Y:24715542-24715564 CAGGAAAACTTCATCCTCTGGGG + Intergenic
1202445797 Y:24954543-24954565 CAGGAAAACTTCATCCTCTGGGG - Intergenic