ID: 1201389039

View in Genome Browser
Species Human (GRCh38)
Location Y:13477352-13477374
Sequence CATTCTTTGGAGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 1, 2: 1, 3: 40, 4: 412}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201389039_1201389045 21 Left 1201389039 Y:13477352-13477374 CCTTCCACCTTCTCCAAAGAATG 0: 1
1: 1
2: 1
3: 40
4: 412
Right 1201389045 Y:13477396-13477418 GAAACGCAGCCCCTTGATCCTGG 0: 1
1: 0
2: 1
3: 8
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201389039 Original CRISPR CATTCTTTGGAGAAGGTGGA AGG (reversed) Intronic
900361435 1:2290970-2290992 CAATCTTTGGCGAGGGTGGCAGG + Intronic
900725257 1:4212380-4212402 CAATCTTGGCAGAAGGTGAAAGG + Intergenic
900877105 1:5350629-5350651 CATTTGAAGGAGAAGGTGGAGGG + Intergenic
902761975 1:18587222-18587244 CATTCTTGGGATCAGGTGGGTGG - Intergenic
902922067 1:19672035-19672057 CATCCTTGGGAGATTGTGGAGGG + Intronic
903011707 1:20335776-20335798 CATTGAGTGGCGAAGGTGGAGGG + Intronic
904050091 1:27633785-27633807 CATGTTTTTGAGAAGGTGAAGGG + Intronic
904302117 1:29561203-29561225 CAATCTCTGGAGAAGGGGGATGG + Intergenic
904310017 1:29622815-29622837 ACTTCTTTGGAGGAGGAGGAGGG + Intergenic
904455171 1:30643088-30643110 CAATCTCTGGAGAAGGGGAATGG - Intergenic
906020031 1:42619799-42619821 CTTTCATGGGAGCAGGTGGATGG - Intronic
907508973 1:54944326-54944348 CAATCATGGGAGAAGGTGAAAGG - Intergenic
908209648 1:61887185-61887207 TAGTCTGTGGAGATGGTGGAGGG + Intronic
908860830 1:68486345-68486367 CAGTCATGGCAGAAGGTGGAGGG - Intronic
911286807 1:96004701-96004723 CATTCTTGGAAGAAGGGGTAGGG + Intergenic
911465978 1:98252446-98252468 CAATCTTTGCAGAAGGTAAAAGG - Intergenic
911686119 1:100779792-100779814 CAATCTTTGCAGAAGGTGAAAGG + Intergenic
912315792 1:108666718-108666740 CATTCATAGCAGAAGGTGAAGGG - Intergenic
912672589 1:111644774-111644796 CTTTTTTTGGGGAAGGGGGAGGG + Intronic
912797384 1:112701284-112701306 CATCCTTTGGGGAAGGTCAAAGG + Exonic
916193451 1:162200649-162200671 AATTCTTTGGAGAATATGGGAGG + Intronic
916552832 1:165865396-165865418 CATGCTTTGCAGGGGGTGGAGGG - Intronic
917608723 1:176664368-176664390 CAGGCTTTGAAGAAGGAGGAAGG - Intronic
917629411 1:176878061-176878083 GATAATTTGGAGAAGGTAGAGGG - Intronic
917904961 1:179579549-179579571 CACTTTATGGACAAGGTGGAAGG + Intergenic
919168281 1:193922051-193922073 CAATCATTGTAGAAGGTGAAGGG - Intergenic
919256117 1:195127689-195127711 CAATCATGGGAGAAGGTGAAGGG + Intergenic
921791524 1:219295895-219295917 CATTCATTGGAGAAGGTGGAAGG - Intergenic
922162968 1:223091660-223091682 CAGACTTGGCAGAAGGTGGAAGG + Intergenic
922748064 1:228058366-228058388 CTTTCTTTGGGGAAGGGGTAGGG - Intronic
923179571 1:231503162-231503184 CAGTCTTGGCAGAAGGTGAAAGG - Intergenic
923570485 1:235108787-235108809 AATGCTTTGGAGAGGGTGGAAGG - Intergenic
924815291 1:247436191-247436213 AATTATTTGGAAAATGTGGATGG + Intronic
924903596 1:248428368-248428390 CAATCATGGGGGAAGGTGGAGGG - Intergenic
924924273 1:248663610-248663632 CAATCATGGGGGAAGGTGGAGGG + Intergenic
1063617713 10:7616035-7616057 CATTCTTGGGTAAAGGAGGAAGG + Exonic
1064116856 10:12585560-12585582 CAATCATGGGAGAAGGTGAATGG + Intronic
1064934464 10:20664403-20664425 CATTCATGGCAGAAGGTGAAGGG - Intergenic
1065385338 10:25128211-25128233 CACTCATGGTAGAAGGTGGAGGG - Intergenic
1066929506 10:41739252-41739274 CACTCTTTGGAGAATCTGGAAGG + Intergenic
1067459416 10:46446388-46446410 CATTCCATGGAGAGGTTGGAGGG + Intergenic
1067627778 10:47938242-47938264 CATTCCATGGAGAGGTTGGAGGG - Intergenic
1068284320 10:54914362-54914384 CAATCATTGCAGAAGGTGAAGGG - Intronic
1068604632 10:58991207-58991229 CAATCATGGGAGAAGGTGAAAGG - Intergenic
1068852970 10:61765555-61765577 CATCCATTGCAGATGGTGGAGGG + Intronic
1070389708 10:75958831-75958853 CAATCGTGGCAGAAGGTGGAAGG + Intronic
1071450279 10:85787026-85787048 CATTGATGGGAGATGGTGGATGG - Intronic
1072390643 10:94982467-94982489 CAATCTTCGGAGAAGGTGAAGGG + Intronic
1072857969 10:98969883-98969905 CAATCATGGGAGAAGGTGAAGGG + Intronic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1075606787 10:123817397-123817419 CATTATTTGCAGAAGATGGCAGG - Intronic
1076350595 10:129812480-129812502 CATTCTTTTGAGAGGGGGAAGGG - Intergenic
1076388998 10:130082618-130082640 CAATCATTGCAGAAGGTGAATGG - Intergenic
1076448086 10:130532362-130532384 CAATCATGGGAGAAGGTGAAGGG + Intergenic
1076528887 10:131131193-131131215 CATTCTTGGGAGAAGGCGGGAGG + Intronic
1078112703 11:8411418-8411440 CATTATTTAGGGAAGGAGGAAGG + Intronic
1078353116 11:10611713-10611735 GATTCTTTGGAGAAGAAGAAAGG - Intronic
1079303771 11:19304401-19304423 CAGTCATGGGAGAAGGTGAAGGG + Intergenic
1079863951 11:25711695-25711717 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1080997138 11:37618057-37618079 CAATCTTGGTAGAAGGTGAAGGG - Intergenic
1081245884 11:40765344-40765366 CAATTATGGGAGAAGGTGGAAGG - Intronic
1081397434 11:42603370-42603392 CATCCTTGGCAGAAGGTAGAAGG + Intergenic
1083209007 11:61171029-61171051 GATTCTATGGAGTAGGAGGAAGG - Intergenic
1083523855 11:63342433-63342455 CATCCCTGGAAGAAGGTGGAAGG + Intronic
1084157359 11:67321363-67321385 CATTCTCTGGAGAGGGAGCACGG - Intronic
1084505328 11:69563257-69563279 CATTCTTTGGAGAAAAAGTATGG - Intergenic
1084614711 11:70227795-70227817 CATACACTGGAGAAGGTGAAAGG + Intergenic
1085079719 11:73624275-73624297 CATTCTTTGGGGAGGTGGGAGGG - Intergenic
1085987006 11:81799939-81799961 CAGTCTTGGCAGAAGGTGAAGGG - Intergenic
1086055218 11:82638738-82638760 ACATCTTTGGAGGAGGTGGAGGG + Intergenic
1086878953 11:92131752-92131774 CATCCCTTGGAGAAGGTGCCGGG + Intergenic
1086993842 11:93334151-93334173 CATGCTTTGGAGACCGTGGTAGG - Intronic
1087061209 11:93979611-93979633 CATTCCTTGAAAAAGGTGGAAGG + Intergenic
1088162699 11:106892616-106892638 CATTCTTTGTTGAAGGAGGAAGG - Intronic
1089649644 11:119904406-119904428 CACTCTTTGAAGAAGGTGAGAGG + Intergenic
1090237468 11:125160077-125160099 CATCCTTTGGAGAAAGGGGTGGG - Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090570137 11:128036803-128036825 CAGTCTTTGGAGAATGTGGTGGG + Intergenic
1091297642 11:134485313-134485335 AATTCTTTGGGGAAGAAGGAAGG - Intergenic
1091302039 11:134514069-134514091 CACTCTATGGAGCAGGTGGGAGG + Intergenic
1091324170 11:134671717-134671739 CAATCTTGGCAGAAGGTGAAGGG + Intergenic
1091693626 12:2613265-2613287 CCCTCTGTGGAGAAGGGGGAAGG + Intronic
1092002317 12:5043210-5043232 GATTCGTTGGAGCGGGTGGAGGG + Intergenic
1093639503 12:21509978-21510000 CAGTGTTTGGAGAAGGTCGGGGG + Intronic
1094656567 12:32425238-32425260 CATTTTTTGTATAAGGTGTAAGG + Intronic
1097318176 12:58195762-58195784 CATTCTTTGAATAATGTGGTTGG + Intergenic
1097541246 12:60946307-60946329 CATTCTTTGGAGAGGGAGAAGGG + Intergenic
1098563835 12:71908433-71908455 CATCCTTTAGAGAAGGTGGTTGG + Intronic
1098685376 12:73412905-73412927 CTTGCTTTGGAGATGGAGGAAGG + Intergenic
1100118171 12:91335066-91335088 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1101051556 12:100868985-100869007 CATCCTGTGGAGAAGGGGGTTGG - Intronic
1101597689 12:106181526-106181548 GATTCTTTGGAAAACTTGGATGG + Intergenic
1102193579 12:111008016-111008038 CAATCCTTGGATAAGGAGGATGG + Intergenic
1102538833 12:113603289-113603311 AATAATTAGGAGAAGGTGGAAGG - Intergenic
1103266102 12:119631614-119631636 TATTCTTAAGAGAAGGTGTAAGG + Intronic
1103412542 12:120722736-120722758 TCTTCTTTGGAGAAGCTAGAAGG - Exonic
1103858855 12:123995544-123995566 CAGGCTTTGGAGAAGGAGAATGG + Intronic
1104722153 12:131050545-131050567 CAGTCATGGCAGAAGGTGGAGGG + Intronic
1104768856 12:131347351-131347373 CATTCATTTCAGAAAGTGGAGGG - Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1105709216 13:22990036-22990058 CAATCATGGCAGAAGGTGGAAGG - Intergenic
1107050605 13:36044173-36044195 CACTCTTGGCAGAAGGTGAAGGG - Intronic
1107307108 13:39034427-39034449 CTTTCTTTGTAGAAGTTGGTAGG - Intronic
1107719057 13:43229171-43229193 CAATCATGGCAGAAGGTGGAAGG - Intronic
1108273177 13:48783091-48783113 CATTCCTAGGGGAAGGGGGAGGG - Intergenic
1108385102 13:49892523-49892545 CCTTCTTTGGATAAAATGGATGG + Intergenic
1108590519 13:51908673-51908695 CCTTCTTTGGATAAAATGGATGG - Intergenic
1109062835 13:57640697-57640719 GATTCTTTTGAGAAGATGGCAGG + Intronic
1109249449 13:60001394-60001416 CATTCTGTGGAGTGGGTGAATGG + Intronic
1109263911 13:60174655-60174677 CATTCTTTTGAGGTGTTGGAGGG - Intergenic
1109381791 13:61571107-61571129 TATCTTTTGAAGAAGGTGGAAGG - Intergenic
1109958537 13:69601816-69601838 CAGTCTTGGCAGAAGGTGAAAGG + Intergenic
1110010545 13:70327487-70327509 CATTCTGTGAAGAATGTGAATGG + Intergenic
1110385388 13:74904826-74904848 CAATCTTAGCAGAAGGTGAAGGG - Intergenic
1110414626 13:75238394-75238416 CCTTCTTTGGATAAAATGGATGG - Intergenic
1110548080 13:76779226-76779248 GATTCTATGATGAAGGTGGAAGG - Intergenic
1110769274 13:79319356-79319378 CATTCTTTGTAGAATGGGGGTGG - Exonic
1110864536 13:80379566-80379588 TATTCTCTGGAGAAGGGAGAAGG - Intergenic
1111463533 13:88577073-88577095 CAATCATGGAAGAAGGTGGAAGG + Intergenic
1112655240 13:101445409-101445431 CAGTCCTTGGAGAAGCTTGAAGG + Intergenic
1112971574 13:105269245-105269267 CAATCATGGTAGAAGGTGGAAGG - Intergenic
1113267220 13:108633062-108633084 CATTGTTTGCAGCAGGAGGAAGG + Intronic
1114975945 14:28099734-28099756 CAATCATGGCAGAAGGTGGAGGG - Intergenic
1115160594 14:30389541-30389563 CAAGCTTTGGAGCAGGGGGAGGG - Intergenic
1115208600 14:30941548-30941570 CATTCTTTGGAGTAGGGGAGGGG + Intronic
1116408718 14:44598258-44598280 CAATCATTGTAGAAGGTGAAGGG + Intergenic
1116420523 14:44727034-44727056 CATTCATGGCAGAAGGTGAAGGG - Intergenic
1117942721 14:60985835-60985857 CATTCATTGTGGAAGGTGAAGGG + Intronic
1118171579 14:63394537-63394559 CATTATTTGGAGAAGGAAAAGGG - Intronic
1118431755 14:65726433-65726455 CAATCTTGGTAGAAGGTGAAAGG + Intronic
1119108729 14:71950397-71950419 TAATCTTTGGATAAGGTGTAAGG - Intronic
1121073564 14:91047480-91047502 CATTCTTTGTAGAAGTAGAATGG - Intronic
1121425148 14:93845354-93845376 CATGCTTTGGGGAGTGTGGAGGG + Intergenic
1121931420 14:97975936-97975958 CATTCTTGGAAGAAGGGTGATGG + Intronic
1122442262 14:101740193-101740215 CAATCATGGCAGAAGGTGGAGGG + Intergenic
1122774583 14:104111617-104111639 CAGCCTTTGGAGAGGGTGCAGGG - Intronic
1125274901 15:37979403-37979425 CATTCTTGGCAGAATGTGGTAGG + Intergenic
1125493777 15:40170375-40170397 GATACTTTGGAGAAGTTTGAGGG + Intronic
1128346334 15:66854738-66854760 CATTCACTGGGGAAGGGGGAGGG + Intergenic
1128358191 15:66943107-66943129 AATTCTGTGGAGAAAGTTGAAGG + Intergenic
1130209981 15:81914106-81914128 GAATCTTGGGAGAAAGTGGAAGG - Intergenic
1131857012 15:96608075-96608097 CATTCCTATGAGAAGGTGGTGGG - Intergenic
1132056674 15:98656156-98656178 CATTCTTTGGAGTAGTGGGGCGG + Intronic
1133647862 16:7781196-7781218 CATTCTGTGGAGGATGTGCATGG + Intergenic
1134330671 16:13248359-13248381 TATTTTTTGGAGAAGGGGGAAGG - Intergenic
1135285577 16:21190000-21190022 CATTCTTAGGAGAAAGTCTATGG - Intergenic
1135500726 16:22993605-22993627 CAATCATGGAAGAAGGTGGAGGG - Intergenic
1135747543 16:25029991-25030013 CATTCTCTGGAGGAGGAGGATGG - Intergenic
1135859671 16:26044350-26044372 CATTCTCTGGAGAGGGGAGAAGG + Intronic
1137886179 16:52106026-52106048 CATGCTCTGGAGAAGATGTAAGG + Intergenic
1140847296 16:78902748-78902770 CATTCTTAGAAGACAGTGGATGG - Intronic
1140906964 16:79417403-79417425 CATTCTATTTTGAAGGTGGAGGG + Intergenic
1141044768 16:80706286-80706308 CATTCTTGTGTGAGGGTGGAGGG - Intronic
1141585120 16:85028282-85028304 CATTCTGGGGAGAGGGTGCAAGG + Intronic
1141745361 16:85922160-85922182 CTTCATTTTGAGAAGGTGGAAGG + Exonic
1142479271 17:208198-208220 CTTTCCTGGTAGAAGGTGGAAGG - Intergenic
1142798874 17:2331570-2331592 CAATCATGGCAGAAGGTGGAGGG - Intronic
1143850082 17:9804373-9804395 TATTCTCTGGAGAAGGTGAACGG + Intronic
1144202002 17:12949940-12949962 GATTCATTGGAGAAGGGGGTTGG + Intronic
1144761123 17:17708072-17708094 CATTCCTTGGAGATGGTGGGTGG - Intronic
1145826095 17:27878215-27878237 CATTCTTCAGAGAAGGTGACTGG - Intronic
1147568596 17:41552927-41552949 CATTCTTTGGAGAAAGTGTTGGG - Intergenic
1147817964 17:43223930-43223952 CACTCTCTGCAGAAGTTGGAAGG + Intergenic
1148706359 17:49636967-49636989 CATTCTTAGGCCAAGGTGGGTGG + Intronic
1148792998 17:50184052-50184074 CCTTCTTTGGAGTTGGGGGAGGG - Exonic
1149438850 17:56657723-56657745 CATTCTTAGGAGAGGGAGTAAGG + Intergenic
1149482056 17:57011601-57011623 AATTCTTCGGAAAATGTGGAGGG + Intergenic
1153723680 18:7934195-7934217 CATTCTTTACAAAAGGTGGATGG - Intronic
1153912085 18:9713293-9713315 CATTTCTTGGGGAAGGGGGATGG + Intronic
1154991483 18:21601547-21601569 CATTTTTTGGAGGTGCTGGAGGG - Intergenic
1155081619 18:22415947-22415969 CCTTCTTTGGATAAAATGGATGG - Exonic
1155109604 18:22700740-22700762 AATTGTTTGGCTAAGGTGGATGG + Intergenic
1155668325 18:28337875-28337897 CAATCATGGCAGAAGGTGGAGGG + Intergenic
1157040169 18:44029129-44029151 CATTCATGGTAGAAGGTGAAGGG + Intergenic
1157091493 18:44642191-44642213 CATTCTGTGGAAAGTGTGGAAGG + Intergenic
1157874362 18:51258647-51258669 AATTCTTTCGAGAACTTGGAGGG - Intergenic
1158898778 18:61941224-61941246 CATTCTTCGGAGAACTTGCAAGG + Intergenic
1159215715 18:65387951-65387973 CAATCATGGTAGAAGGTGGAAGG - Intergenic
1159632733 18:70767620-70767642 CATTCTGTGAAGAATGTGAATGG - Intergenic
1159802723 18:72920842-72920864 CATTATTTGTATAAGGTGGCAGG - Intergenic
1159841556 18:73404565-73404587 CAATCATTGCAGAAGGTGAAGGG + Intergenic
1164771553 19:30813531-30813553 CTTTCTTGGGAGGAGGTTGAGGG - Intergenic
1166582871 19:43918086-43918108 CTCTCTTTGGAAGAGGTGGATGG + Intronic
1167834890 19:52060410-52060432 CATTCTCTGGTGAAACTGGAAGG + Intronic
1168164715 19:54538852-54538874 GATCCTTTAGAGCAGGTGGAAGG + Intronic
924998784 2:387070-387092 CACTGTTTGGAGAAAGTGAAGGG - Intergenic
925120154 2:1411985-1412007 TCTTCTTGGGAGAATGTGGATGG - Intronic
925654947 2:6136671-6136693 TATACTTTGGAGAAAGTGGAAGG - Intergenic
926839248 2:17060256-17060278 CTTTCTATTGAGAAGGTGGATGG + Intergenic
927041416 2:19234413-19234435 CAGTGCTTGGAGAAGGGGGAAGG + Intergenic
928196524 2:29220319-29220341 CAATCATTGCAGAAGGTGAAGGG - Intronic
928811342 2:35231064-35231086 CATTCATGGCAGAAGGTGAAGGG - Intergenic
929862070 2:45687423-45687445 CATTTATTGTTGAAGGTGGAGGG + Intronic
929967374 2:46545201-46545223 CCTTCATTGGAGGATGTGGAGGG + Intronic
930687677 2:54326487-54326509 CAATCATGGTAGAAGGTGGAGGG - Intergenic
930722189 2:54648353-54648375 CACTCTGGGGAGAAGTTGGAGGG + Intronic
931382740 2:61768361-61768383 CACTCTTGGTAGAAGGTGAAGGG + Intergenic
931386525 2:61802836-61802858 CATGCTTTGGAGAAAGTGCATGG - Intergenic
932953572 2:76323781-76323803 GATTCTTTGGGGAGGGAGGAGGG - Intergenic
933053988 2:77638340-77638362 CACTCTTGGGAGAAGGGGGAGGG - Intergenic
934055129 2:88244945-88244967 CAATCTTGGCAGAAGGTGAAAGG - Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934921536 2:98348107-98348129 CGTTCTTTGGGGTAGGGGGAAGG + Intronic
936703698 2:115044251-115044273 CAATCATTGTAGAAGGTGAAGGG + Intronic
937117945 2:119422345-119422367 CATTCTTGGTGGAAGGTGAAGGG + Intergenic
937561551 2:123230924-123230946 CCTGCTTTGGTGAAGGTGGTAGG + Intergenic
939275970 2:139996500-139996522 CACTCTCAGGAGAAGGTGAAAGG - Intergenic
939512781 2:143127220-143127242 TTTTCTTTGTATAAGGTGGAAGG - Intronic
939551377 2:143619819-143619841 CAATCATGGGAGAAGGTGAAGGG - Intronic
942437077 2:175990370-175990392 CATTCTTGGCAGAAGGTGACAGG - Intronic
942764971 2:179444187-179444209 GAGGCTTTGGAGAAGCTGGAAGG + Intronic
942968347 2:181925408-181925430 CATGCTATGGAGAGGTTGGAAGG - Intronic
942970198 2:181949429-181949451 CATTCATGGCAGAAGGTGAATGG + Intergenic
943644902 2:190399776-190399798 CATTCATTAGAGAAGTTGCAAGG - Intergenic
943701257 2:190990237-190990259 CGTTCAGTGGAGCAGGTGGATGG + Intronic
945842363 2:214903296-214903318 CATTTTTAAGAGGAGGTGGAGGG + Intergenic
946710226 2:222497835-222497857 CCTACTTTAGAGAAGGTGGTTGG + Intronic
947832812 2:233153747-233153769 TATTCTTTGGAGAAGGTGAAGGG + Intronic
947897450 2:233688882-233688904 CAATCTTGGGAGAAGTTGGGGGG + Intronic
948710854 2:239824689-239824711 CAATCATGGCAGAAGGTGGAAGG - Intergenic
1169633199 20:7656994-7657016 CATTCTAGGGAGAGGGGGGAGGG + Intergenic
1170717786 20:18847021-18847043 CATTCATGGTAGAAGGTGAAAGG + Intergenic
1171453726 20:25254471-25254493 CATTCTTAGGATACGGTGAAGGG + Intronic
1172482366 20:35278315-35278337 CATTCTTTGACTAAGGTGGATGG - Intergenic
1172818021 20:37705030-37705052 ACTTCATTGGAGAATGTGGATGG + Intronic
1173259760 20:41423214-41423236 TATACTTTGGAGAAAGTGGTTGG + Intronic
1174962104 20:55170117-55170139 CCTTTTTTTGAGAAAGTGGAAGG + Intergenic
1177351304 21:19945418-19945440 CATTCTGTGAAGAAGGTCAATGG + Intergenic
1178628973 21:34243050-34243072 CATCCTCTGGGGCAGGTGGAAGG + Intergenic
1178939628 21:36894181-36894203 CAATCGTTGCAGAAGGTGAAGGG - Intronic
1179000671 21:37455100-37455122 AATTCTTGGGAGATGGGGGAGGG + Intronic
1180626808 22:17199155-17199177 CAACCTTTGGAGAAGGTGCTGGG - Intronic
1180677355 22:17596482-17596504 CACTCATGGCAGAAGGTGGAAGG - Intronic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1180942556 22:19668881-19668903 CAGTCTTTGTGGAAGGTGAACGG + Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1182536878 22:31010427-31010449 CAATCATGGCAGAAGGTGGAGGG - Intergenic
1184914069 22:47555555-47555577 CAATCATGGCAGAAGGTGGAGGG + Intergenic
1185343832 22:50302890-50302912 CCTGCTTTGGAGGAGATGGAGGG - Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
950559077 3:13711613-13711635 TATTCTTGGGAGCACGTGGAGGG + Intergenic
950832116 3:15885274-15885296 CAATCATTGTAGAAGGTGAAAGG + Intergenic
951269700 3:20608784-20608806 CATCCATAGGAGAAGGAGGAAGG + Intergenic
951494418 3:23310543-23310565 GATTCTTTGGACAAGGCAGAAGG + Intronic
952246970 3:31605596-31605618 CAATCTTGGCAGAAGGTGAAAGG - Intronic
952419390 3:33117758-33117780 CAGATTTTGGAGAAGGTGGTAGG - Intronic
952592758 3:34977142-34977164 AATTCTGTGGAGAAAGTTGATGG + Intergenic
954852606 3:53616330-53616352 CATTCTGTGGAGGTGGGGGAAGG + Intronic
955848630 3:63195343-63195365 CATTCCTTGGAGGAGGTGGGGGG + Intergenic
956030190 3:65028850-65028872 CAATCATGGGAGAAGGTGAAAGG - Intergenic
957165587 3:76668899-76668921 CTTTCTTTGGAGGAAGAGGATGG + Intronic
957550529 3:81697786-81697808 CCTGCTTTGGAGCAGGTGGAAGG + Intronic
958163894 3:89854102-89854124 CCTTTTTTGGAGAAGGAGTAGGG + Intergenic
958967026 3:100570519-100570541 CATGCTTTGGAGGAAGTGAATGG - Intronic
959892944 3:111577063-111577085 CAACCTTTGGATAAGTTGGAAGG + Intronic
960225865 3:115167899-115167921 CAATCATTGTAGAAGGTGAAGGG + Intergenic
961478384 3:127163325-127163347 CAGGCTTTGGAGAGGGTGGAAGG + Intergenic
961925028 3:130470014-130470036 AAGTCCTTGGAGTAGGTGGAGGG - Intronic
961925913 3:130480448-130480470 AATTCTATGGGGAAAGTGGAAGG + Intronic
962491291 3:135896544-135896566 CATTGTGTGGAGAAACTGGAGGG + Intergenic
963490121 3:145989164-145989186 CATTCATGGAAGAAGGTGAAGGG - Intergenic
965272403 3:166635642-166635664 AAATATTTGGAGCAGGTGGATGG + Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966052156 3:175632342-175632364 CAATCTTGGCAGAAGGTGAAGGG - Intronic
966427564 3:179796182-179796204 CATTCATTGGGGGAGGGGGAGGG - Exonic
969041060 4:4296533-4296555 CAATCTTGGCAGAAGGTGAAAGG - Intronic
970327659 4:14944148-14944170 CCTTCTTTGTAAAAGGTGGGTGG - Intergenic
970592456 4:17571328-17571350 CACTCTTTGCAGAAGCTGGTGGG - Intergenic
971663257 4:29448021-29448043 CATTCTTTGGACAATTTGGCTGG + Intergenic
971851921 4:31995164-31995186 CATGCTTTGAAGGGGGTGGAGGG + Intergenic
972000586 4:34027554-34027576 CAGTCTTCGCAGAAGGTGAATGG - Intergenic
972261491 4:37412955-37412977 CATTTTTTGTATAAGGTGTAAGG - Intronic
974121966 4:57649663-57649685 CATTCATGGCAGGAGGTGGAAGG + Intergenic
974216031 4:58848781-58848803 CACCCTGTGCAGAAGGTGGAAGG - Intergenic
974292168 4:59947411-59947433 CATTTTCTGGGGAAGGAGGAGGG - Intergenic
975351323 4:73350614-73350636 CATTCATGGCAGAAGGTGAAGGG + Intergenic
976117664 4:81745210-81745232 CAATCGTGGTAGAAGGTGGAGGG + Intronic
976922763 4:90458232-90458254 CACTCCATGGAGCAGGTGGAAGG - Intronic
977086478 4:92605063-92605085 CAATCATAGCAGAAGGTGGAGGG - Intronic
977772642 4:100878123-100878145 CATTCATGGCAGAAGGTGAAGGG + Intronic
977809969 4:101347100-101347122 TATTCTTGGGGGAAGGGGGATGG + Exonic
978177902 4:105756293-105756315 CATTCTCTGGAGAGGGGAGAGGG - Intronic
978256104 4:106694454-106694476 CAATCTTGGCAGAAGGTGAAAGG - Intergenic
978417120 4:108488340-108488362 CAATCATGGCAGAAGGTGGAAGG + Intergenic
978420412 4:108526764-108526786 GAATATGTGGAGAAGGTGGAAGG - Intergenic
978666935 4:111195191-111195213 CAATCATAGCAGAAGGTGGAGGG - Intergenic
978875699 4:113637992-113638014 CATATTTGGGAGAAGGAGGATGG - Intronic
979585809 4:122415570-122415592 GTTTCTTTGGAGATTGTGGATGG + Exonic
979846269 4:125516561-125516583 CAATCATGGGAGAAGGTGAAGGG + Intergenic
980184465 4:129444875-129444897 CATCATTTGGAGAAGGTACAAGG + Intergenic
980282758 4:130741797-130741819 TATCCTTTGGAGAACATGGATGG - Intergenic
981646191 4:147001472-147001494 CAATCATTGCAGAAGGTGAAGGG + Intergenic
982126353 4:152187113-152187135 CTTTCTTGGGAGATGATGGAAGG + Intergenic
983873625 4:172851051-172851073 CATTCTCTGGAGAAGGAAGGGGG - Intronic
983953644 4:173672365-173672387 CACTCATAGGAGAAGATGGAGGG + Intergenic
984084863 4:175297118-175297140 AATTTTTTGGAGATGGTGCAAGG - Intergenic
985523372 5:389552-389574 CATTCTGTGGAAAAGCTCGAGGG + Intronic
985945859 5:3182632-3182654 CATTTTGTGGAGCAGGTTGAAGG - Intergenic
985972454 5:3389200-3389222 CATTCACTGGACAAGGTGGTGGG + Intergenic
986185577 5:5433353-5433375 GATTCTTTTGAGAAGGTGAAGGG - Intronic
987162032 5:15154803-15154825 CAATCATGGGGGAAGGTGGAGGG + Intergenic
987226540 5:15847623-15847645 CATTATATGGAAAAGGTGGGGGG + Intronic
988433243 5:31144393-31144415 CATGCTTTAGAGAAGTGGGAAGG - Intergenic
989434810 5:41398375-41398397 CAATCATTGCAGAAGGTGAAGGG - Intronic
989969075 5:50499549-50499571 CAATCTTTGTATAAGGTGTAAGG - Intergenic
991325782 5:65430497-65430519 TATTCTTTGGAGAAACTGGATGG + Intronic
991549899 5:67824510-67824532 CATTCATTGCAGAAGGTAAAGGG - Intergenic
991562834 5:67972611-67972633 CAATCTTGGCAGAAGGTGAAGGG + Intergenic
992113362 5:73516665-73516687 CTTTTTTTGGAGGAGGGGGACGG + Intergenic
992375141 5:76181543-76181565 CAATCTTGGCAGAAGGTGAAGGG + Intronic
992549800 5:77849714-77849736 CCTTCTCTGGAGAGGGTGCAGGG + Intronic
992642568 5:78780624-78780646 CATTGTATTGAGACGGTGGAGGG + Exonic
993034313 5:82740323-82740345 CCTCCTTTGGAGAAGGTTGGGGG - Intergenic
993638360 5:90372235-90372257 CAATCATGGGAGAAGGTGAAAGG + Intergenic
994087004 5:95770001-95770023 CAGTGTTTGGAGAAGGGGGTAGG + Intronic
994785533 5:104156574-104156596 CAATCTTTGCAAAAGGTGAAGGG - Intergenic
994863713 5:105235098-105235120 CATACTTTGAAGGAGGTGGGAGG - Intergenic
996557579 5:124794957-124794979 TATGCTTTGGGGAAGGTGAAAGG - Intergenic
997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG + Intergenic
997682032 5:135763527-135763549 TATTCTATGGAGGAGGAGGAGGG + Intergenic
997817882 5:137035662-137035684 CATTCTTGTGACAAGGGGGAGGG - Intronic
998487552 5:142516331-142516353 CATTCATGGCAGAAGGTGAAGGG - Intergenic
998507547 5:142684252-142684274 CATTCAGTGGAGATGGTGGGCGG - Intronic
998650105 5:144109280-144109302 GATACTTTGGAAAATGTGGATGG - Intergenic
998765974 5:145487716-145487738 CATTTTTTAGAGATGGAGGAAGG + Intronic
999655087 5:153803461-153803483 CATTCTTTGTGGAAGGTGAAAGG - Intronic
999677170 5:154015554-154015576 CATCCTTAGGAAAAGGGGGAAGG + Intronic
1000922670 5:167157165-167157187 CATTCTTTGTACAAGGTAGAAGG - Intergenic
1001132234 5:169073761-169073783 CAATCATTGCAGAAGGTGAAGGG - Intronic
1001535637 5:172496015-172496037 CATTCACTGGTGAAGGTGGGAGG - Intergenic
1003008676 6:2405813-2405835 CAATCTTGGCAGAAGGTGAATGG + Intergenic
1003164601 6:3665267-3665289 GCTTATTAGGAGAAGGTGGAGGG - Intergenic
1003953566 6:11141613-11141635 CATTCATGGCAGAAGGTGAAGGG - Intergenic
1004736918 6:18416069-18416091 GTTTCTTTGGAGAAAGTAGAAGG + Intronic
1004775268 6:18837291-18837313 CATTCTTTGGACACTGTGAATGG - Intergenic
1005256126 6:24005205-24005227 CATTCATGGCAGAAGGTGAAGGG + Intergenic
1006865120 6:37203237-37203259 CAGAAGTTGGAGAAGGTGGATGG + Intergenic
1007793803 6:44330869-44330891 CAATCATGGCAGAAGGTGGAAGG - Intronic
1008252511 6:49257690-49257712 CATGCTGGGGAGAAGGTGAAGGG - Intergenic
1008696400 6:54043499-54043521 CTTTCTTTAGAGAGGGTTGAGGG - Intronic
1009052431 6:58292514-58292536 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1009238679 6:61158100-61158122 CAGTCATGGCAGAAGGTGGAGGG - Intergenic
1010676892 6:78755778-78755800 CAGTCTTGGCAGAAGGTGAAGGG - Intergenic
1011329885 6:86192394-86192416 CACTCTTGGAAGAAGGTGAAAGG - Intergenic
1012029947 6:94046296-94046318 CTTTCTGAAGAGAAGGTGGAAGG - Intergenic
1012087141 6:94842538-94842560 CATTGTTTGGAGAAAGGTGAAGG + Intergenic
1012295071 6:97512310-97512332 CAATCATTGCAGAAGGTGAAGGG + Intergenic
1012764745 6:103352641-103352663 CATTCCTGGTGGAAGGTGGAAGG + Intergenic
1013281213 6:108638837-108638859 GATTCTTTGGAAAAAGTGAATGG + Intronic
1013745532 6:113341208-113341230 TCTGCTTTGGAGAAGATGGAAGG + Intergenic
1013772023 6:113638432-113638454 GACTCTTTGGGGAAGGTAGAAGG - Intergenic
1014689583 6:124546694-124546716 AAGTCTTAGGAGAAAGTGGAAGG + Intronic
1014788223 6:125642018-125642040 GATTCTTAGGAGAAGGCAGAAGG + Intergenic
1015186369 6:130421000-130421022 GATTCTTTTTGGAAGGTGGAAGG - Intronic
1015211936 6:130708564-130708586 CACTCATTGCAGAAGGTGGAGGG + Intergenic
1015301257 6:131655355-131655377 CATTCTTTGTAAAATGAGGATGG - Intronic
1015555228 6:134454190-134454212 CATTGTGTGGAGAAGGTTGGAGG - Intergenic
1016222284 6:141689521-141689543 CAATCATTGTAGAAGGTGAAGGG - Intergenic
1017099162 6:150832221-150832243 CTTACTTTGGAGAAGGAAGAAGG - Intronic
1017219555 6:151950123-151950145 CAATCATGGCAGAAGGTGGAAGG - Intronic
1017702549 6:157089471-157089493 CATTCTTTGGAGAAGCAGAATGG + Intronic
1017723322 6:157259333-157259355 TATTCTGTTGAGATGGTGGAAGG + Intergenic
1017953966 6:159162664-159162686 TCTTCTATGGAGAAGGGGGAAGG + Intergenic
1018116544 6:160591381-160591403 CATATTTGGCAGAAGGTGGAAGG - Intronic
1018507292 6:164485033-164485055 CAATCATGGGAGAAGGTGAAGGG + Intergenic
1018938127 6:168287361-168287383 CCTTCTTTGGATAAAATGGATGG - Intergenic
1019343860 7:520356-520378 CAGTCTTTGGGGAAGGAGGGGGG + Intergenic
1020217091 7:6201455-6201477 CCTTCTTTGGATTAGGTGAAAGG + Intronic
1021608478 7:22433284-22433306 CATTATGTGGAGGGGGTGGAAGG - Intronic
1021608512 7:22433463-22433485 CATTATGTGGAGGGGGTGGAAGG - Intronic
1021982224 7:26065960-26065982 CTTTCTTGGGAGAAGTGGGATGG - Intergenic
1023235308 7:38080602-38080624 CAATCTTGGCAGAAGGTGAAGGG + Intergenic
1023650653 7:42365358-42365380 CAATCATGGTAGAAGGTGGAAGG + Intergenic
1024509230 7:50190112-50190134 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1027854547 7:83492620-83492642 CATACTTTGGAGAAAGCAGAGGG + Intronic
1028792668 7:94870806-94870828 CAATCGTGGGAGAAGGTGAAAGG + Intergenic
1029568760 7:101357534-101357556 CATTATGCGGGGAAGGTGGAAGG + Intergenic
1030752312 7:113242759-113242781 AAATCATTGGAGAAGGTGAAGGG - Intergenic
1031419762 7:121537425-121537447 AAATCTGTGGAGAAGATGGAAGG - Intergenic
1031435743 7:121729781-121729803 CAATCATGGGAGAAGGTGAAGGG + Intergenic
1031637444 7:124119006-124119028 CAATCATTGTAGAAGGTGAAGGG - Intergenic
1033586083 7:142775366-142775388 GATTCTTTAAAAAAGGTGGAAGG + Intergenic
1034783154 7:153900474-153900496 CACTCATGGCAGAAGGTGGAGGG + Intronic
1035235369 7:157494474-157494496 CACTCTTGGCAGAAGGTGAAGGG + Intergenic
1035285572 7:157804465-157804487 CATTCTCTGGAGCAGCTGCATGG - Intronic
1035438350 7:158876144-158876166 CAGTCTTAGGAGAAGGTGAAGGG + Intronic
1036594954 8:10203173-10203195 CATGAATTGGAGAAGGTGGAGGG - Intronic
1036607134 8:10317505-10317527 TCTTCTTTGGAGAAAGTGGATGG + Intronic
1037293111 8:17372198-17372220 CATTTTTAGCAGAAGGTGGCAGG - Intronic
1037321134 8:17644466-17644488 GAGACTTTGGAAAAGGTGGAAGG - Exonic
1038240814 8:25806652-25806674 CAATCATGGGAGAAGGTGAAGGG - Intergenic
1038671461 8:29586458-29586480 CATTCCTTCCAGAAGGTGGGAGG + Intergenic
1038922927 8:32105353-32105375 CAATCATGGCAGAAGGTGGAAGG + Intronic
1041324666 8:56651823-56651845 CAATCTTGTGAGCAGGTGGAAGG + Intergenic
1041525653 8:58802483-58802505 CATTGCTTGGAGAAAGGGGATGG - Intergenic
1042383474 8:68147068-68147090 CATTTTTTTTAGAATGTGGAGGG - Intronic
1042498158 8:69478988-69479010 CATTCTTTTGACAATGTGGAAGG + Intronic
1042752990 8:72178777-72178799 CAATCATTGCAGAAGGTGAAGGG + Intergenic
1043937332 8:86156563-86156585 CATGCTGTGGAGGGGGTGGAGGG - Intergenic
1044406112 8:91828186-91828208 AAGACTTTGGAGAAGGTTGATGG - Intergenic
1044449268 8:92314525-92314547 CATTCTTTGCAGAGAGTAGAGGG - Intergenic
1044565506 8:93657878-93657900 CAATCTTTGGAGTAGGAGGCAGG + Intergenic
1044586989 8:93877334-93877356 CATGCTTTGGGGGAGGTAGAAGG - Intronic
1045059231 8:98397876-98397898 CAATCATGGTAGAAGGTGGAGGG - Intergenic
1045297184 8:100882349-100882371 TGTTCTTTGGTGAAGGTGGCTGG + Intergenic
1046300019 8:112275615-112275637 CAATCATGGCAGAAGGTGGAAGG + Intronic
1046705405 8:117444456-117444478 TTGTGTTTGGAGAAGGTGGAAGG + Intergenic
1046807403 8:118494876-118494898 CATTATTTGGGGTAGATGGAAGG - Intronic
1047282656 8:123459456-123459478 CATTCTTTAGAGATGGGGAAGGG - Intronic
1047942504 8:129839088-129839110 CAATCATGGGAGAAGGTGAAAGG - Intergenic
1048865652 8:138759631-138759653 CATTCTTTGCAAAATGTGAAGGG - Intronic
1048976555 8:139676251-139676273 CATTGTTGGGAGAAGAGGGAAGG - Intronic
1049046667 8:140157406-140157428 CTTTCTGTGGACCAGGTGGAGGG + Intronic
1049282889 8:141759496-141759518 CATTATTTAGAGAAAGAGGAAGG + Intergenic
1049493535 8:142917471-142917493 CATCCTTTGGAGGATGGGGAAGG - Intronic
1050063931 9:1738850-1738872 CCTAATTTGGAGAAGGAGGAGGG - Intergenic
1051963328 9:22794925-22794947 CATTCTTATGAGAAATTGGAAGG - Intergenic
1052365599 9:27608839-27608861 ACTTCTTTGGATAAAGTGGATGG - Intergenic
1052572889 9:30251044-30251066 CTTTCTTTGGTGCATGTGGATGG - Intergenic
1055058046 9:72041527-72041549 CTGTCTTTGCAGACGGTGGAAGG + Intergenic
1055523764 9:77109194-77109216 CATTCGTCGCAGAAGGTGAAGGG - Intergenic
1056073172 9:83010265-83010287 CATTCGTTCAAGATGGTGGATGG + Intronic
1056736748 9:89216158-89216180 TATTTTTAGGAGAAGGTGGTAGG - Intergenic
1056846838 9:90045725-90045747 CATTCTTTGCAGATGTTGGATGG + Intergenic
1057901715 9:98953973-98953995 CACTCTCTGGAGTAGGTGGCAGG + Intronic
1058179272 9:101777655-101777677 CATTGTTGGGGGAAGGTGGTGGG - Intergenic
1058327903 9:103721147-103721169 CTTTCTTTGAATAAGATGGAGGG - Intergenic
1060483829 9:124034464-124034486 CATTGTTGGGATAGGGTGGAGGG + Intergenic
1060962027 9:127687787-127687809 CATTTTTTAGACAATGTGGAGGG - Intronic
1061716648 9:132522456-132522478 CATTCTTTTGAGGCGCTGGAGGG - Intronic
1062161345 9:135081902-135081924 CATGCTTTGCACAAGGTGGCTGG + Intronic
1187110294 X:16291810-16291832 CAACCTTGGGAGAAGGAGGAAGG - Intergenic
1188674094 X:32917214-32917236 CAATCTTGGCAGAAGGTGAAGGG - Intronic
1189552875 X:42111787-42111809 CATTCATGGTAGAAGGTGAAGGG + Intergenic
1190916008 X:54811639-54811661 TATTCCTTGGAGAAGGTGAAGGG + Exonic
1190952873 X:55163051-55163073 CATTCTCTGAGGAAGGTGGAGGG + Intronic
1191042438 X:56098177-56098199 CATTCATAGCAGAAGGTGAAAGG - Intergenic
1192256880 X:69468853-69468875 CAATCTTGGGAGAAGGGGAAGGG - Intergenic
1192919903 X:75695787-75695809 CAATCATTGCAGAAGGTGAAAGG + Intergenic
1193886466 X:86988049-86988071 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1194172947 X:90611236-90611258 CATTCATGGCAGAAGGTGAAGGG + Intergenic
1194936870 X:99960819-99960841 CCTTCTTTGGAGGGGGTTGAAGG - Intergenic
1195755234 X:108193092-108193114 CAGTCTTTGGAGAAGGTAAAGGG + Intronic
1196637270 X:118017047-118017069 GATTATTTGGGGAAGGAGGACGG - Intronic
1198059179 X:133026805-133026827 TATTCTTTGGGGAAGGTTGATGG + Exonic
1198171043 X:134105498-134105520 CATTCATAGAAGAAGGTGAAAGG + Intergenic
1198298013 X:135305719-135305741 CCCTGTTTAGAGAAGGTGGAAGG - Intronic
1199137546 X:144270889-144270911 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1199203076 X:145116189-145116211 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1199537340 X:148917637-148917659 CAGTAGTTGGAGAAGTTGGATGG + Intronic
1199785074 X:151098047-151098069 CACTCATTGCAGAAGGTGAAGGG - Intergenic
1200034302 X:153318247-153318269 CAGTCCTGGGAGATGGTGGAAGG - Intergenic
1201389039 Y:13477352-13477374 CATTCTTTGGAGAAGGTGGAAGG - Intronic