ID: 1201394887

View in Genome Browser
Species Human (GRCh38)
Location Y:13537541-13537563
Sequence GGGCACTAAATAATAATAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201394883_1201394887 4 Left 1201394883 Y:13537514-13537536 CCAACAACAGTAAAAAAGGACAA 0: 28
1: 64
2: 114
3: 203
4: 1084
Right 1201394887 Y:13537541-13537563 GGGCACTAAATAATAATAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201394887 Original CRISPR GGGCACTAAATAATAATAAA GGG Intergenic
No off target data available for this crispr