ID: 1201401818

View in Genome Browser
Species Human (GRCh38)
Location Y:13611668-13611690
Sequence CGGGCAGTTACACAGTTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201401818_1201401829 12 Left 1201401818 Y:13611668-13611690 CCATCTAACTGTGTAACTGCCCG No data
Right 1201401829 Y:13611703-13611725 GGGTTGACATACCCTCAGTGGGG No data
1201401818_1201401828 11 Left 1201401818 Y:13611668-13611690 CCATCTAACTGTGTAACTGCCCG No data
Right 1201401828 Y:13611702-13611724 GGGGTTGACATACCCTCAGTGGG No data
1201401818_1201401824 -8 Left 1201401818 Y:13611668-13611690 CCATCTAACTGTGTAACTGCCCG No data
Right 1201401824 Y:13611683-13611705 ACTGCCCGGCTTGCTGGGAGGGG No data
1201401818_1201401823 -9 Left 1201401818 Y:13611668-13611690 CCATCTAACTGTGTAACTGCCCG No data
Right 1201401823 Y:13611682-13611704 AACTGCCCGGCTTGCTGGGAGGG No data
1201401818_1201401827 10 Left 1201401818 Y:13611668-13611690 CCATCTAACTGTGTAACTGCCCG No data
Right 1201401827 Y:13611701-13611723 AGGGGTTGACATACCCTCAGTGG No data
1201401818_1201401822 -10 Left 1201401818 Y:13611668-13611690 CCATCTAACTGTGTAACTGCCCG No data
Right 1201401822 Y:13611681-13611703 TAACTGCCCGGCTTGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201401818 Original CRISPR CGGGCAGTTACACAGTTAGA TGG (reversed) Intergenic
No off target data available for this crispr