ID: 1201412404

View in Genome Browser
Species Human (GRCh38)
Location Y:13713412-13713434
Sequence ACTAGCAAGGAAGAGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201412404_1201412416 17 Left 1201412404 Y:13713412-13713434 CCTTCTGCCTCTTCCTTGCTAGT No data
Right 1201412416 Y:13713452-13713474 GTCCAGGATGGGGGCGTGGCAGG No data
1201412404_1201412409 1 Left 1201412404 Y:13713412-13713434 CCTTCTGCCTCTTCCTTGCTAGT No data
Right 1201412409 Y:13713436-13713458 TCTCCGGTATTTATAGGTCCAGG No data
1201412404_1201412412 6 Left 1201412404 Y:13713412-13713434 CCTTCTGCCTCTTCCTTGCTAGT No data
Right 1201412412 Y:13713441-13713463 GGTATTTATAGGTCCAGGATGGG No data
1201412404_1201412414 8 Left 1201412404 Y:13713412-13713434 CCTTCTGCCTCTTCCTTGCTAGT No data
Right 1201412414 Y:13713443-13713465 TATTTATAGGTCCAGGATGGGGG No data
1201412404_1201412419 23 Left 1201412404 Y:13713412-13713434 CCTTCTGCCTCTTCCTTGCTAGT No data
Right 1201412419 Y:13713458-13713480 GATGGGGGCGTGGCAGGCCAGGG 0: 43
1: 125
2: 164
3: 165
4: 471
1201412404_1201412420 26 Left 1201412404 Y:13713412-13713434 CCTTCTGCCTCTTCCTTGCTAGT No data
Right 1201412420 Y:13713461-13713483 GGGGGCGTGGCAGGCCAGGGTGG 0: 37
1: 135
2: 212
3: 278
4: 1147
1201412404_1201412418 22 Left 1201412404 Y:13713412-13713434 CCTTCTGCCTCTTCCTTGCTAGT No data
Right 1201412418 Y:13713457-13713479 GGATGGGGGCGTGGCAGGCCAGG 0: 36
1: 135
2: 151
3: 191
4: 686
1201412404_1201412411 5 Left 1201412404 Y:13713412-13713434 CCTTCTGCCTCTTCCTTGCTAGT No data
Right 1201412411 Y:13713440-13713462 CGGTATTTATAGGTCCAGGATGG No data
1201412404_1201412413 7 Left 1201412404 Y:13713412-13713434 CCTTCTGCCTCTTCCTTGCTAGT No data
Right 1201412413 Y:13713442-13713464 GTATTTATAGGTCCAGGATGGGG No data
1201412404_1201412408 -5 Left 1201412404 Y:13713412-13713434 CCTTCTGCCTCTTCCTTGCTAGT No data
Right 1201412408 Y:13713430-13713452 CTAGTTTCTCCGGTATTTATAGG No data
1201412404_1201412415 13 Left 1201412404 Y:13713412-13713434 CCTTCTGCCTCTTCCTTGCTAGT No data
Right 1201412415 Y:13713448-13713470 ATAGGTCCAGGATGGGGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201412404 Original CRISPR ACTAGCAAGGAAGAGGCAGA AGG (reversed) Intergenic
No off target data available for this crispr