ID: 1201412408

View in Genome Browser
Species Human (GRCh38)
Location Y:13713430-13713452
Sequence CTAGTTTCTCCGGTATTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201412404_1201412408 -5 Left 1201412404 Y:13713412-13713434 CCTTCTGCCTCTTCCTTGCTAGT No data
Right 1201412408 Y:13713430-13713452 CTAGTTTCTCCGGTATTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201412408 Original CRISPR CTAGTTTCTCCGGTATTTAT AGG Intergenic
No off target data available for this crispr