ID: 1201416495

View in Genome Browser
Species Human (GRCh38)
Location Y:13752932-13752954
Sequence CGCACCCAGAGCCTCCGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201416495_1201416504 11 Left 1201416495 Y:13752932-13752954 CCTGCGCGGAGGCTCTGGGTGCG No data
Right 1201416504 Y:13752966-13752988 TATGGCAGGTTTCGGACTCAGGG No data
1201416495_1201416500 -7 Left 1201416495 Y:13752932-13752954 CCTGCGCGGAGGCTCTGGGTGCG No data
Right 1201416500 Y:13752948-13752970 GGGTGCGGGTGGGCACACTATGG No data
1201416495_1201416505 12 Left 1201416495 Y:13752932-13752954 CCTGCGCGGAGGCTCTGGGTGCG No data
Right 1201416505 Y:13752967-13752989 ATGGCAGGTTTCGGACTCAGGGG No data
1201416495_1201416501 -3 Left 1201416495 Y:13752932-13752954 CCTGCGCGGAGGCTCTGGGTGCG No data
Right 1201416501 Y:13752952-13752974 GCGGGTGGGCACACTATGGCAGG No data
1201416495_1201416502 3 Left 1201416495 Y:13752932-13752954 CCTGCGCGGAGGCTCTGGGTGCG No data
Right 1201416502 Y:13752958-13752980 GGGCACACTATGGCAGGTTTCGG No data
1201416495_1201416506 13 Left 1201416495 Y:13752932-13752954 CCTGCGCGGAGGCTCTGGGTGCG No data
Right 1201416506 Y:13752968-13752990 TGGCAGGTTTCGGACTCAGGGGG No data
1201416495_1201416503 10 Left 1201416495 Y:13752932-13752954 CCTGCGCGGAGGCTCTGGGTGCG No data
Right 1201416503 Y:13752965-13752987 CTATGGCAGGTTTCGGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201416495 Original CRISPR CGCACCCAGAGCCTCCGCGC AGG (reversed) Intergenic
No off target data available for this crispr