ID: 1201419457

View in Genome Browser
Species Human (GRCh38)
Location Y:13782446-13782468
Sequence GAGCCCACTGCAGCTCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6903
Summary {0: 307, 1: 591, 2: 3701, 3: 1447, 4: 857}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201419457_1201419463 25 Left 1201419457 Y:13782446-13782468 CCTCCTTGAGCTGCAGTGGGCTC 0: 307
1: 591
2: 3701
3: 1447
4: 857
Right 1201419463 Y:13782494-13782516 TTTGTTTACCTACTCAAGCCTGG 0: 86
1: 551
2: 2132
3: 545
4: 247
1201419457_1201419464 26 Left 1201419457 Y:13782446-13782468 CCTCCTTGAGCTGCAGTGGGCTC 0: 307
1: 591
2: 3701
3: 1447
4: 857
Right 1201419464 Y:13782495-13782517 TTGTTTACCTACTCAAGCCTGGG 0: 408
1: 745
2: 2190
3: 577
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201419457 Original CRISPR GAGCCCACTGCAGCTCAAGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr