ID: 1201419458

View in Genome Browser
Species Human (GRCh38)
Location Y:13782449-13782471
Sequence GTGGAGCCCACTGCAGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6189
Summary {0: 300, 1: 591, 2: 3574, 3: 1212, 4: 512}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201419458_1201419464 23 Left 1201419458 Y:13782449-13782471 CCTTGAGCTGCAGTGGGCTCCAC 0: 300
1: 591
2: 3574
3: 1212
4: 512
Right 1201419464 Y:13782495-13782517 TTGTTTACCTACTCAAGCCTGGG 0: 408
1: 745
2: 2190
3: 577
4: 252
1201419458_1201419465 29 Left 1201419458 Y:13782449-13782471 CCTTGAGCTGCAGTGGGCTCCAC 0: 300
1: 591
2: 3574
3: 1212
4: 512
Right 1201419465 Y:13782501-13782523 ACCTACTCAAGCCTGGGCAATGG 0: 78
1: 970
2: 3739
3: 2049
4: 1722
1201419458_1201419463 22 Left 1201419458 Y:13782449-13782471 CCTTGAGCTGCAGTGGGCTCCAC 0: 300
1: 591
2: 3574
3: 1212
4: 512
Right 1201419463 Y:13782494-13782516 TTTGTTTACCTACTCAAGCCTGG 0: 86
1: 551
2: 2132
3: 545
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201419458 Original CRISPR GTGGAGCCCACTGCAGCTCA AGG (reversed) Intergenic
Too many off-targets to display for this crispr