ID: 1201419460

View in Genome Browser
Species Human (GRCh38)
Location Y:13782471-13782493
Sequence GCAGCAAGGAAGTTCAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201419460_1201419465 7 Left 1201419460 Y:13782471-13782493 CCCAGTTTGAACTTCCTTGCTGC No data
Right 1201419465 Y:13782501-13782523 ACCTACTCAAGCCTGGGCAATGG No data
1201419460_1201419467 10 Left 1201419460 Y:13782471-13782493 CCCAGTTTGAACTTCCTTGCTGC No data
Right 1201419467 Y:13782504-13782526 TACTCAAGCCTGGGCAATGGCGG No data
1201419460_1201419463 0 Left 1201419460 Y:13782471-13782493 CCCAGTTTGAACTTCCTTGCTGC No data
Right 1201419463 Y:13782494-13782516 TTTGTTTACCTACTCAAGCCTGG No data
1201419460_1201419464 1 Left 1201419460 Y:13782471-13782493 CCCAGTTTGAACTTCCTTGCTGC No data
Right 1201419464 Y:13782495-13782517 TTGTTTACCTACTCAAGCCTGGG No data
1201419460_1201419468 11 Left 1201419460 Y:13782471-13782493 CCCAGTTTGAACTTCCTTGCTGC No data
Right 1201419468 Y:13782505-13782527 ACTCAAGCCTGGGCAATGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201419460 Original CRISPR GCAGCAAGGAAGTTCAAACT GGG (reversed) Intergenic