ID: 1201419461

View in Genome Browser
Species Human (GRCh38)
Location Y:13782472-13782494
Sequence AGCAGCAAGGAAGTTCAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201419461_1201419467 9 Left 1201419461 Y:13782472-13782494 CCAGTTTGAACTTCCTTGCTGCT No data
Right 1201419467 Y:13782504-13782526 TACTCAAGCCTGGGCAATGGCGG 0: 55
1: 730
2: 3251
3: 2259
4: 4552
1201419461_1201419463 -1 Left 1201419461 Y:13782472-13782494 CCAGTTTGAACTTCCTTGCTGCT No data
Right 1201419463 Y:13782494-13782516 TTTGTTTACCTACTCAAGCCTGG 0: 86
1: 551
2: 2132
3: 545
4: 247
1201419461_1201419464 0 Left 1201419461 Y:13782472-13782494 CCAGTTTGAACTTCCTTGCTGCT No data
Right 1201419464 Y:13782495-13782517 TTGTTTACCTACTCAAGCCTGGG 0: 408
1: 745
2: 2190
3: 577
4: 252
1201419461_1201419468 10 Left 1201419461 Y:13782472-13782494 CCAGTTTGAACTTCCTTGCTGCT No data
Right 1201419468 Y:13782505-13782527 ACTCAAGCCTGGGCAATGGCGGG 0: 59
1: 785
2: 2481
3: 1672
4: 3692
1201419461_1201419465 6 Left 1201419461 Y:13782472-13782494 CCAGTTTGAACTTCCTTGCTGCT No data
Right 1201419465 Y:13782501-13782523 ACCTACTCAAGCCTGGGCAATGG 0: 78
1: 970
2: 3739
3: 2049
4: 1722

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201419461 Original CRISPR AGCAGCAAGGAAGTTCAAAC TGG (reversed) Intergenic
No off target data available for this crispr