ID: 1201419462

View in Genome Browser
Species Human (GRCh38)
Location Y:13782485-13782507
Sequence AGTAGGTAAACAAAGCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6721
Summary {0: 24, 1: 720, 2: 1518, 3: 3230, 4: 1229}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201419462_1201419467 -4 Left 1201419462 Y:13782485-13782507 CCTTGCTGCTTTGTTTACCTACT 0: 24
1: 720
2: 1518
3: 3230
4: 1229
Right 1201419467 Y:13782504-13782526 TACTCAAGCCTGGGCAATGGCGG 0: 55
1: 730
2: 3251
3: 2259
4: 4552
1201419462_1201419468 -3 Left 1201419462 Y:13782485-13782507 CCTTGCTGCTTTGTTTACCTACT 0: 24
1: 720
2: 1518
3: 3230
4: 1229
Right 1201419468 Y:13782505-13782527 ACTCAAGCCTGGGCAATGGCGGG 0: 59
1: 785
2: 2481
3: 1672
4: 3692
1201419462_1201419465 -7 Left 1201419462 Y:13782485-13782507 CCTTGCTGCTTTGTTTACCTACT 0: 24
1: 720
2: 1518
3: 3230
4: 1229
Right 1201419465 Y:13782501-13782523 ACCTACTCAAGCCTGGGCAATGG 0: 78
1: 970
2: 3739
3: 2049
4: 1722

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201419462 Original CRISPR AGTAGGTAAACAAAGCAGCA AGG (reversed) Intergenic
Too many off-targets to display for this crispr