ID: 1201419463

View in Genome Browser
Species Human (GRCh38)
Location Y:13782494-13782516
Sequence TTTGTTTACCTACTCAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3561
Summary {0: 86, 1: 551, 2: 2132, 3: 545, 4: 247}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201419460_1201419463 0 Left 1201419460 Y:13782471-13782493 CCCAGTTTGAACTTCCTTGCTGC No data
Right 1201419463 Y:13782494-13782516 TTTGTTTACCTACTCAAGCCTGG 0: 86
1: 551
2: 2132
3: 545
4: 247
1201419459_1201419463 3 Left 1201419459 Y:13782468-13782490 CCACCCAGTTTGAACTTCCTTGC No data
Right 1201419463 Y:13782494-13782516 TTTGTTTACCTACTCAAGCCTGG 0: 86
1: 551
2: 2132
3: 545
4: 247
1201419458_1201419463 22 Left 1201419458 Y:13782449-13782471 CCTTGAGCTGCAGTGGGCTCCAC 0: 300
1: 591
2: 3574
3: 1212
4: 512
Right 1201419463 Y:13782494-13782516 TTTGTTTACCTACTCAAGCCTGG 0: 86
1: 551
2: 2132
3: 545
4: 247
1201419457_1201419463 25 Left 1201419457 Y:13782446-13782468 CCTCCTTGAGCTGCAGTGGGCTC 0: 307
1: 591
2: 3701
3: 1447
4: 857
Right 1201419463 Y:13782494-13782516 TTTGTTTACCTACTCAAGCCTGG 0: 86
1: 551
2: 2132
3: 545
4: 247
1201419461_1201419463 -1 Left 1201419461 Y:13782472-13782494 CCAGTTTGAACTTCCTTGCTGCT No data
Right 1201419463 Y:13782494-13782516 TTTGTTTACCTACTCAAGCCTGG 0: 86
1: 551
2: 2132
3: 545
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201419463 Original CRISPR TTTGTTTACCTACTCAAGCC TGG Intergenic
Too many off-targets to display for this crispr