ID: 1201419465

View in Genome Browser
Species Human (GRCh38)
Location Y:13782501-13782523
Sequence ACCTACTCAAGCCTGGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8558
Summary {0: 78, 1: 970, 2: 3739, 3: 2049, 4: 1722}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201419458_1201419465 29 Left 1201419458 Y:13782449-13782471 CCTTGAGCTGCAGTGGGCTCCAC 0: 300
1: 591
2: 3574
3: 1212
4: 512
Right 1201419465 Y:13782501-13782523 ACCTACTCAAGCCTGGGCAATGG 0: 78
1: 970
2: 3739
3: 2049
4: 1722
1201419460_1201419465 7 Left 1201419460 Y:13782471-13782493 CCCAGTTTGAACTTCCTTGCTGC No data
Right 1201419465 Y:13782501-13782523 ACCTACTCAAGCCTGGGCAATGG 0: 78
1: 970
2: 3739
3: 2049
4: 1722
1201419462_1201419465 -7 Left 1201419462 Y:13782485-13782507 CCTTGCTGCTTTGTTTACCTACT 0: 24
1: 720
2: 1518
3: 3230
4: 1229
Right 1201419465 Y:13782501-13782523 ACCTACTCAAGCCTGGGCAATGG 0: 78
1: 970
2: 3739
3: 2049
4: 1722
1201419461_1201419465 6 Left 1201419461 Y:13782472-13782494 CCAGTTTGAACTTCCTTGCTGCT No data
Right 1201419465 Y:13782501-13782523 ACCTACTCAAGCCTGGGCAATGG 0: 78
1: 970
2: 3739
3: 2049
4: 1722
1201419459_1201419465 10 Left 1201419459 Y:13782468-13782490 CCACCCAGTTTGAACTTCCTTGC No data
Right 1201419465 Y:13782501-13782523 ACCTACTCAAGCCTGGGCAATGG 0: 78
1: 970
2: 3739
3: 2049
4: 1722

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201419465 Original CRISPR ACCTACTCAAGCCTGGGCAA TGG Intergenic
Too many off-targets to display for this crispr