ID: 1201419467

View in Genome Browser
Species Human (GRCh38)
Location Y:13782504-13782526
Sequence TACTCAAGCCTGGGCAATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10847
Summary {0: 55, 1: 730, 2: 3251, 3: 2259, 4: 4552}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201419461_1201419467 9 Left 1201419461 Y:13782472-13782494 CCAGTTTGAACTTCCTTGCTGCT No data
Right 1201419467 Y:13782504-13782526 TACTCAAGCCTGGGCAATGGCGG 0: 55
1: 730
2: 3251
3: 2259
4: 4552
1201419459_1201419467 13 Left 1201419459 Y:13782468-13782490 CCACCCAGTTTGAACTTCCTTGC No data
Right 1201419467 Y:13782504-13782526 TACTCAAGCCTGGGCAATGGCGG 0: 55
1: 730
2: 3251
3: 2259
4: 4552
1201419462_1201419467 -4 Left 1201419462 Y:13782485-13782507 CCTTGCTGCTTTGTTTACCTACT 0: 24
1: 720
2: 1518
3: 3230
4: 1229
Right 1201419467 Y:13782504-13782526 TACTCAAGCCTGGGCAATGGCGG 0: 55
1: 730
2: 3251
3: 2259
4: 4552
1201419460_1201419467 10 Left 1201419460 Y:13782471-13782493 CCCAGTTTGAACTTCCTTGCTGC No data
Right 1201419467 Y:13782504-13782526 TACTCAAGCCTGGGCAATGGCGG 0: 55
1: 730
2: 3251
3: 2259
4: 4552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201419467 Original CRISPR TACTCAAGCCTGGGCAATGG CGG Intergenic
Too many off-targets to display for this crispr